Incidental Mutation 'R6868:Slx4ip'
ID536005
Institutional Source Beutler Lab
Gene Symbol Slx4ip
Ensembl Gene ENSMUSG00000027281
Gene NameSLX4 interacting protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6868 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location136891218-137071950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137000210 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 18 (D18E)
Ref Sequence ENSEMBL: ENSMUSP00000136131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028737] [ENSMUST00000099311] [ENSMUST00000141463] [ENSMUST00000180277]
Predicted Effect probably damaging
Transcript: ENSMUST00000028737
AA Change: D18E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028737
Gene: ENSMUSG00000027281
AA Change: D18E

DomainStartEndE-ValueType
low complexity region 271 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099311
AA Change: D18E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096914
Gene: ENSMUSG00000027281
AA Change: D18E

DomainStartEndE-ValueType
Pfam:UPF0492 10 365 6.4e-170 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141463
AA Change: D34E
Predicted Effect probably damaging
Transcript: ENSMUST00000180277
AA Change: D18E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136131
Gene: ENSMUSG00000027281
AA Change: D18E

DomainStartEndE-ValueType
low complexity region 341 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Slx4ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Slx4ip APN 2 137044055 nonsense probably null
IGL01546:Slx4ip APN 2 137066199 missense probably benign
IGL02114:Slx4ip APN 2 137000200 missense probably damaging 1.00
IGL02142:Slx4ip APN 2 137068022 missense possibly damaging 0.87
IGL02253:Slx4ip APN 2 137000275 critical splice donor site probably null
IGL02826:Slx4ip APN 2 137004973 missense probably damaging 1.00
IGL03035:Slx4ip APN 2 137067703 missense possibly damaging 0.50
IGL03261:Slx4ip APN 2 137046739 missense probably benign 0.01
R0561:Slx4ip UTSW 2 137066170 missense probably null 0.27
R1750:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R1774:Slx4ip UTSW 2 137067723 missense probably damaging 0.99
R1812:Slx4ip UTSW 2 137068195 missense probably benign 0.13
R1894:Slx4ip UTSW 2 137068118 missense probably benign 0.02
R1961:Slx4ip UTSW 2 137067681 missense probably benign 0.02
R2051:Slx4ip UTSW 2 137066205 missense possibly damaging 0.90
R2263:Slx4ip UTSW 2 137044015 missense probably damaging 1.00
R2914:Slx4ip UTSW 2 137067591 critical splice acceptor site probably null
R3798:Slx4ip UTSW 2 137067623 missense probably benign 0.19
R4061:Slx4ip UTSW 2 137005017 missense probably benign 0.08
R4934:Slx4ip UTSW 2 137068347 utr 3 prime probably benign
R4944:Slx4ip UTSW 2 137046767 missense probably benign 0.17
R5061:Slx4ip UTSW 2 137044010 missense probably damaging 1.00
R5465:Slx4ip UTSW 2 137004947 missense probably damaging 1.00
R5609:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R6112:Slx4ip UTSW 2 137046744 missense probably damaging 1.00
R6391:Slx4ip UTSW 2 137046749 missense probably damaging 1.00
R6525:Slx4ip UTSW 2 137000218 missense possibly damaging 0.72
R6944:Slx4ip UTSW 2 137068275 missense probably damaging 1.00
R6966:Slx4ip UTSW 2 137068224 missense probably damaging 0.96
R7214:Slx4ip UTSW 2 137046730 missense probably benign 0.15
R7406:Slx4ip UTSW 2 137000242 missense probably damaging 1.00
R7711:Slx4ip UTSW 2 137067994 missense probably damaging 1.00
R8035:Slx4ip UTSW 2 137044025 nonsense probably null
R8181:Slx4ip UTSW 2 137000184 missense probably damaging 1.00
R9032:Slx4ip UTSW 2 137068320 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTGTGAACACTAGGAGCCATGC -3'
(R):5'- TCCTGCCTTTCAGTGAACGC -3'

Sequencing Primer
(F):5'- CACTAGGAGCCATGCTGAGATTC -3'
(R):5'- GCTGACATTTCTTCTATCTGG -3'
Posted On2018-10-18