Mutagenetix > Incidental Mutation

Incidental Mutation 'R6868:Gss'

536006

Institutional Source

Beutler Lab

Gene Symbol

Gss

Ensembl Gene

ENSMUSG00000027610

Gene Name

glutathione synthetase

Synonyms

GS-A/GS-B

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6868 (G1)

Quality Score

218.009

Status

Not validated

Chromosome

Chromosomal Location

155563181-155592810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155567812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 235 (T235A)

Ref Sequence

ENSEMBL: ENSMUSP00000135319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000130881]

AlphaFold

P51855

Predicted Effect

probably benign
Transcript: ENSMUST00000065973

SMART Domains

Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	575	4.8e-98	PFAM
Pfam:AMP-binding_C	583	660	3.1e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079691
AA Change: T304A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610
AA Change: T304A

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	12	472	6.7e-131	PFAM
Pfam:GSH_synthase	204	302	2.5e-36	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130881
AA Change: T235A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610
AA Change: T235A

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	1	404	9.2e-130	PFAM
Pfam:GSH_synthase	133	233	9e-38	PFAM

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	T	16: 14,618,695	N204I	probably damaging	Het
Aasdh	C	T	5: 76,891,680	V261M	probably damaging	Het
Adgrg7	A	G	16: 56,773,476	F126L	probably benign	Het
Agxt2	T	C	15: 10,373,769	L87P	probably damaging	Het
Alcam	G	A	16: 52,268,385	S554F	probably damaging	Het
Ambra1	T	C	2: 91,917,533	S1205P	possibly damaging	Het
Bst2	A	C	8: 71,534,760	V150G	unknown	Het
C3	T	C	17: 57,204,029	Y1659C	possibly damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Cdk4	T	C	10: 127,065,001	V174A	probably benign	Het
Ces2h	T	A	8: 105,018,423	N396K	probably benign	Het
Chd7	T	C	4: 8,811,501		probably null	Het
Cnih4	A	G	1: 181,166,197	I76V	probably null	Het
Csmd2	G	A	4: 128,442,840	V1404I	probably benign	Het
Ctrb1	T	C	8: 111,689,403	D53G	probably benign	Het
Cul9	C	A	17: 46,522,183	R1323L	possibly damaging	Het
Dchs1	A	G	7: 105,763,503	V1230A	possibly damaging	Het
Dgat2	T	C	7: 99,158,306	D219G	probably benign	Het
Dgkh	T	C	14: 78,624,853	T225A	probably damaging	Het
Dock9	G	T	14: 121,586,264	A1412E	probably benign	Het
Dscam	C	T	16: 96,829,940	V292M	probably damaging	Het
Fam183b	C	T	11: 58,792,906	D113N	probably damaging	Het
Fras1	T	A	5: 96,682,378	V1509E	probably benign	Het
Fryl	T	C	5: 73,068,803	Q1839R	probably damaging	Het
Gcat	A	G	15: 79,035,366	D177G	probably damaging	Het
Ints10	T	A	8: 68,797,798	M114K	probably damaging	Het
Ints5	T	G	19: 8,897,386	L903R	probably damaging	Het
Lipo2	G	T	19: 33,748,462	P130Q	possibly damaging	Het
Megf11	G	A	9: 64,680,309	C494Y	probably damaging	Het
Milr1	T	C	11: 106,763,921	Y162H	probably damaging	Het
Mrc2	T	A	11: 105,328,418	I278N	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Myh15	G	A	16: 49,069,403	C119Y	probably damaging	Het
Nap1l1	G	A	10: 111,494,808	G358D	probably damaging	Het
Nav3	T	C	10: 109,693,166	I2178V	possibly damaging	Het
Nkx2-5	T	C	17: 26,841,294	E21G	probably damaging	Het
Nos2	C	T	11: 78,957,506	R967C	probably benign	Het
Olfr811	T	C	10: 129,802,168	D119G	probably damaging	Het
Parp10	T	C	15: 76,243,106	R44G	probably damaging	Het
Pced1b	A	G	15: 97,384,341	H87R	probably damaging	Het
Ppfia3	T	A	7: 45,353,612	L524F	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,438	T376A	probably benign	Het
Ppp4r4	T	C	12: 103,590,852	L449P	probably damaging	Het
Prkd1	T	C	12: 50,425,537	R198G	probably damaging	Het
Pth2r	C	A	1: 65,388,479	A437E	probably benign	Het
Ptprh	A	T	7: 4,601,865	I60N	probably benign	Het
Pxmp2	C	T	5: 110,285,980	R9Q	probably damaging	Het
Scarb2	T	C	5: 92,485,309	K55E	probably benign	Het
Slc18b1	T	C	10: 23,804,234	V109A	possibly damaging	Het
Slx4ip	T	A	2: 137,000,210	D18E	probably damaging	Het
Stk40	A	G	4: 126,123,814	R45G	probably damaging	Het
Tbxas1	A	T	6: 39,084,306	Q513L	probably damaging	Het
Tcf4	A	T	18: 69,657,650		probably null	Het
Tmc6	T	A	11: 117,774,317	I377F	probably benign	Het
Tmem131l	T	C	3: 83,961,631	I146V	probably damaging	Het
Trac	T	A	14: 54,220,592		probably benign	Het
Trpm7	T	C	2: 126,837,414	D409G	probably damaging	Het
Usp39	A	T	6: 72,337,751	V224E	possibly damaging	Het
Vmn1r184	A	C	7: 26,267,302	M158L	probably benign	Het
Vmn2r120	T	A	17: 57,545,218	I33L	probably benign	Het

Other mutations in Gss

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Gss	APN	2	155581951	missense	probably damaging	1.00
IGL01737:Gss	APN	2	155567806	missense	probably damaging	1.00
IGL01783:Gss	APN	2	155571559	missense	probably damaging	1.00
IGL02329:Gss	APN	2	155567853	missense	probably benign	0.01
IGL02386:Gss	APN	2	155573170	missense	probably benign	0.01
IGL02948:Gss	APN	2	155577621	missense	probably damaging	1.00
PIT4515001:Gss	UTSW	2	155578341	missense	probably damaging	1.00
R0230:Gss	UTSW	2	155578406	missense	probably damaging	1.00
R0446:Gss	UTSW	2	155567745	missense	probably benign	0.00
R0931:Gss	UTSW	2	155567689	intron	probably benign
R1396:Gss	UTSW	2	155567721	missense	probably damaging	0.99
R2896:Gss	UTSW	2	155564829	missense	probably damaging	1.00
R2986:Gss	UTSW	2	155587443	missense	probably benign	0.21
R4852:Gss	UTSW	2	155564865	missense	probably benign	0.06
R5148:Gss	UTSW	2	155573109	missense	possibly damaging	0.80
R6017:Gss	UTSW	2	155587465	missense	probably benign
R6574:Gss	UTSW	2	155582011	missense	probably damaging	1.00
R8274:Gss	UTSW	2	155587504	missense	probably benign	0.00
R8510:Gss	UTSW	2	155567824	nonsense	probably null
R8801:Gss	UTSW	2	155564766	missense	probably damaging	1.00
R8903:Gss	UTSW	2	155578359	missense	probably damaging	0.99
R9038:Gss	UTSW	2	155564874	missense

Predicted Primers

PCR Primer
(F):5'- TGTGATACACCCTCACCAGC -3'
(R):5'- ACTCCTGAAAGGCTAGCATCTTG -3'

Sequencing Primer
(F):5'- GCACATTTGCCGTCTCTGTTG -3'
(R):5'- GGTCATATCTGCCTCACAAGGATG -3'

Posted On

2018-10-18