Incidental Mutation 'R6868:Csmd2'
ID536010
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6868 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128442840 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1404 (V1404I)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: V1404I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- ATGCTTCCAGACGATGCCTC -3'
(R):5'- CAGATATCTGAATAAACCATGAGCCAG -3'

Sequencing Primer
(F):5'- CTCTACTGATGGGAAGATCCTG -3'
(R):5'- CATGAGCCAGATACACAGCAGATG -3'
Posted On2018-10-18