Incidental Mutation 'R6868:Ptprh'
ID536018
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6868 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4601865 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 60 (I60N)
Ref Sequence ENSEMBL: ENSMUSP00000145543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect probably benign
Transcript: ENSMUST00000049113
AA Change: I60N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: I60N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166650
AA Change: I60N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: I60N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206999
AA Change: I60N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7177:Ptprh UTSW 7 4569481 missense possibly damaging 0.77
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
R7863:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
R7946:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
RF022:Ptprh UTSW 7 4549368 missense probably benign
Z1177:Ptprh UTSW 7 4597971 missense probably damaging 0.99
Z1177:Ptprh UTSW 7 4598118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTACATGAACTATGGGG -3'
(R):5'- AGCCCATTGAGAAACCCGAG -3'

Sequencing Primer
(F):5'- TACATGAACTATGGGGGCCCC -3'
(R):5'- AGGTCCCTGATGGCACTGAC -3'
Posted On2018-10-18