Incidental Mutation 'R6868:Dgat2'
ID536021
Institutional Source Beutler Lab
Gene Symbol Dgat2
Ensembl Gene ENSMUSG00000030747
Gene Namediacylglycerol O-acyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6868 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99153658-99182719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99158306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000033001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033001] [ENSMUST00000207491] [ENSMUST00000208591]
Predicted Effect probably benign
Transcript: ENSMUST00000033001
AA Change: D219G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033001
Gene: ENSMUSG00000030747
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Pfam:DAGAT 92 388 5.3e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207491
Predicted Effect probably benign
Transcript: ENSMUST00000208591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutant mice die shortly after birth due to inadequate substrates for energy and impaired skin barrier function leading to dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Dgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Dgat2 UTSW 7 99157135 missense probably damaging 1.00
R0532:Dgat2 UTSW 7 99169781 missense possibly damaging 0.46
R1726:Dgat2 UTSW 7 99182416 missense possibly damaging 0.83
R2386:Dgat2 UTSW 7 99157093 missense possibly damaging 0.79
R3429:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3430:Dgat2 UTSW 7 99157093 missense probably benign 0.05
R3881:Dgat2 UTSW 7 99169743 nonsense probably null
R4279:Dgat2 UTSW 7 99164705 missense probably damaging 1.00
R4280:Dgat2 UTSW 7 99158997 missense probably damaging 1.00
R4719:Dgat2 UTSW 7 99158297 missense probably benign 0.01
R6019:Dgat2 UTSW 7 99154631 missense probably benign 0.13
R6152:Dgat2 UTSW 7 99164678 missense probably benign 0.20
R7143:Dgat2 UTSW 7 99157124 missense probably benign 0.00
R7362:Dgat2 UTSW 7 99154636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTTGTGTGAAGGCAC -3'
(R):5'- GCTAGGGCTTCATAGATCTTGC -3'

Sequencing Primer
(F):5'- ACTTACCCATGGCGCAGG -3'
(R):5'- GCTGAATTTTCTCAAAACCACTCTG -3'
Posted On2018-10-18