Incidental Mutation 'R6868:Bst2'
ID 536024
Institutional Source Beutler Lab
Gene Symbol Bst2
Ensembl Gene ENSMUSG00000046718
Gene Name bone marrow stromal cell antigen 2
Synonyms Bst-2, C87040, 2310015I10Rik, GREG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6868 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71534255-71537456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 71534760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 150 (V150G)
Ref Sequence ENSEMBL: ENSMUSP00000051921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051672]
AlphaFold Q8R2Q8
PDB Structure Crystal Structure of Mouse BST-2/Tetherin Ectodomain [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000051672
AA Change: V150G
SMART Domains Protein: ENSMUSP00000051921
Gene: ENSMUSG00000046718
AA Change: V150G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Pfam:BST2 54 144 1.9e-37 PFAM
low complexity region 148 171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to the LP-BM5 strain of Mo-MLV (murine AIDS). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Nos2 C T 11: 78,957,506 R967C probably benign Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Bst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Bst2 APN 8 71537186 missense probably damaging 0.97
R0158:Bst2 UTSW 8 71537217 missense possibly damaging 0.95
R6383:Bst2 UTSW 8 71537288 missense possibly damaging 0.95
R7109:Bst2 UTSW 8 71537282 missense possibly damaging 0.93
R7322:Bst2 UTSW 8 71537207 missense probably damaging 0.99
R8109:Bst2 UTSW 8 71537346 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTCTGGGCCCAAGTATATCC -3'
(R):5'- ACGTGCATACCTCTGACTCC -3'

Sequencing Primer
(F):5'- TGGGCCCAAGTATATCCCACATG -3'
(R):5'- CTGGTAGGACTCCTGCATAGAATC -3'
Posted On 2018-10-18