Incidental Mutation 'R6868:Slc18b1'
ID 536029
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Name solute carrier family 18, subfamily B, member 1
Synonyms 1110021L09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6868 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 23672884-23703866 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23680132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000116940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000133289] [ENSMUST00000134170] [ENSMUST00000179321]
AlphaFold D3Z5L6
Predicted Effect probably benign
Transcript: ENSMUST00000119597
AA Change: V109A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127841
Predicted Effect possibly damaging
Transcript: ENSMUST00000133289
AA Change: V127A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121289
Gene: ENSMUSG00000037455
AA Change: V127A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134170
AA Change: V109A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116940
Gene: ENSMUSG00000037455
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 129 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179321
AA Change: V109A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,559 (GRCm39) N204I probably damaging Het
Aasdh C T 5: 77,039,527 (GRCm39) V261M probably damaging Het
Adgrg7 A G 16: 56,593,839 (GRCm39) F126L probably benign Het
Agxt2 T C 15: 10,373,855 (GRCm39) L87P probably damaging Het
Alcam G A 16: 52,088,748 (GRCm39) S554F probably damaging Het
Ambra1 T C 2: 91,747,878 (GRCm39) S1205P possibly damaging Het
Bst2 A C 8: 71,987,404 (GRCm39) V150G unknown Het
C3 T C 17: 57,511,029 (GRCm39) Y1659C possibly damaging Het
Cacna1s G A 1: 136,020,432 (GRCm39) R823Q probably benign Het
Cdk4 T C 10: 126,900,870 (GRCm39) V174A probably benign Het
Ces2h T A 8: 105,745,055 (GRCm39) N396K probably benign Het
Cfap144 C T 11: 58,683,732 (GRCm39) D113N probably damaging Het
Chd7 T C 4: 8,811,501 (GRCm39) probably null Het
Cnih4 A G 1: 180,993,762 (GRCm39) I76V probably null Het
Csmd2 G A 4: 128,336,633 (GRCm39) V1404I probably benign Het
Ctrb1 T C 8: 112,416,035 (GRCm39) D53G probably benign Het
Cul9 C A 17: 46,833,109 (GRCm39) R1323L possibly damaging Het
Dchs1 A G 7: 105,412,710 (GRCm39) V1230A possibly damaging Het
Dgat2 T C 7: 98,807,513 (GRCm39) D219G probably benign Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dock9 G T 14: 121,823,676 (GRCm39) A1412E probably benign Het
Dscam C T 16: 96,631,140 (GRCm39) V292M probably damaging Het
Fras1 T A 5: 96,830,237 (GRCm39) V1509E probably benign Het
Fryl T C 5: 73,226,146 (GRCm39) Q1839R probably damaging Het
Gcat A G 15: 78,919,566 (GRCm39) D177G probably damaging Het
Gss T C 2: 155,409,732 (GRCm39) T235A possibly damaging Het
Ints10 T A 8: 69,250,450 (GRCm39) M114K probably damaging Het
Ints5 T G 19: 8,874,750 (GRCm39) L903R probably damaging Het
Lipo2 G T 19: 33,725,862 (GRCm39) P130Q possibly damaging Het
Megf11 G A 9: 64,587,591 (GRCm39) C494Y probably damaging Het
Milr1 T C 11: 106,654,747 (GRCm39) Y162H probably damaging Het
Mrc2 T A 11: 105,219,244 (GRCm39) I278N probably damaging Het
Mst1r T A 9: 107,793,132 (GRCm39) probably null Het
Myh15 G A 16: 48,889,766 (GRCm39) C119Y probably damaging Het
Nap1l1 G A 10: 111,330,669 (GRCm39) G358D probably damaging Het
Nav3 T C 10: 109,529,027 (GRCm39) I2178V possibly damaging Het
Nkx2-5 T C 17: 27,060,268 (GRCm39) E21G probably damaging Het
Nos2 C T 11: 78,848,332 (GRCm39) R967C probably benign Het
Or6c215 T C 10: 129,638,037 (GRCm39) D119G probably damaging Het
Parp10 T C 15: 76,127,306 (GRCm39) R44G probably damaging Het
Pced1b A G 15: 97,282,222 (GRCm39) H87R probably damaging Het
Ppfia3 T A 7: 45,003,036 (GRCm39) L524F probably damaging Het
Ppp1r12b T C 1: 134,814,176 (GRCm39) T376A probably benign Het
Ppp4r4 T C 12: 103,557,111 (GRCm39) L449P probably damaging Het
Prkd1 T C 12: 50,472,320 (GRCm39) R198G probably damaging Het
Pth2r C A 1: 65,427,638 (GRCm39) A437E probably benign Het
Ptprh A T 7: 4,604,864 (GRCm39) I60N probably benign Het
Pxmp2 C T 5: 110,433,846 (GRCm39) R9Q probably damaging Het
Scarb2 T C 5: 92,633,168 (GRCm39) K55E probably benign Het
Slx4ip T A 2: 136,842,130 (GRCm39) D18E probably damaging Het
Stk40 A G 4: 126,017,607 (GRCm39) R45G probably damaging Het
Tbxas1 A T 6: 39,061,240 (GRCm39) Q513L probably damaging Het
Tcf4 A T 18: 69,790,721 (GRCm39) probably null Het
Tmc6 T A 11: 117,665,143 (GRCm39) I377F probably benign Het
Tmem131l T C 3: 83,868,938 (GRCm39) I146V probably damaging Het
Trac T A 14: 54,458,049 (GRCm39) probably benign Het
Trpm7 T C 2: 126,679,334 (GRCm39) D409G probably damaging Het
Usp39 A T 6: 72,314,734 (GRCm39) V224E possibly damaging Het
Vmn1r184 A C 7: 25,966,727 (GRCm39) M158L probably benign Het
Vmn2r120 T A 17: 57,852,218 (GRCm39) I33L probably benign Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23,700,659 (GRCm39) critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23,679,748 (GRCm39) missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23,701,899 (GRCm39) missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23,686,850 (GRCm39) splice site probably benign
IGL03049:Slc18b1 APN 10 23,698,844 (GRCm39) missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23,702,557 (GRCm39) makesense probably null
R0440:Slc18b1 UTSW 10 23,694,976 (GRCm39) missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23,681,936 (GRCm39) missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23,679,693 (GRCm39) missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23,674,639 (GRCm39) splice site probably benign
R1842:Slc18b1 UTSW 10 23,681,891 (GRCm39) missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23,686,820 (GRCm39) missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3765:Slc18b1 UTSW 10 23,674,647 (GRCm39) missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23,674,647 (GRCm39) missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23,681,879 (GRCm39) missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23,696,767 (GRCm39) missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23,674,664 (GRCm39) missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23,700,565 (GRCm39) intron probably benign
R6084:Slc18b1 UTSW 10 23,680,110 (GRCm39) missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23,692,227 (GRCm39) missense probably benign 0.02
R6959:Slc18b1 UTSW 10 23,701,942 (GRCm39) splice site probably null
R7632:Slc18b1 UTSW 10 23,702,080 (GRCm39) missense probably benign
R8101:Slc18b1 UTSW 10 23,698,841 (GRCm39) missense probably damaging 1.00
R8757:Slc18b1 UTSW 10 23,692,198 (GRCm39) synonymous silent
R8838:Slc18b1 UTSW 10 23,696,764 (GRCm39) missense probably benign 0.25
R8868:Slc18b1 UTSW 10 23,686,751 (GRCm39) missense probably damaging 0.98
R9112:Slc18b1 UTSW 10 23,692,262 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGCCTCTGGACAGTGTAC -3'
(R):5'- GCTGGTTGGTTTAAAGAGCC -3'

Sequencing Primer
(F):5'- CCTCTGGACAGTGTACATTAAAATTC -3'
(R):5'- TGGCAACCTGAGTTCGATAC -3'
Posted On 2018-10-18