Incidental Mutation 'R6868:Nos2'
ID 536035
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6868 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78957506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 967 (R967C)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
Predicted Effect probably benign
Transcript: ENSMUST00000018610
AA Change: R1080C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: R1080C

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214397
AA Change: R967C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,695 N204I probably damaging Het
Aasdh C T 5: 76,891,680 V261M probably damaging Het
Adgrg7 A G 16: 56,773,476 F126L probably benign Het
Agxt2 T C 15: 10,373,769 L87P probably damaging Het
Alcam G A 16: 52,268,385 S554F probably damaging Het
Ambra1 T C 2: 91,917,533 S1205P possibly damaging Het
Bst2 A C 8: 71,534,760 V150G unknown Het
C3 T C 17: 57,204,029 Y1659C possibly damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cdk4 T C 10: 127,065,001 V174A probably benign Het
Ces2h T A 8: 105,018,423 N396K probably benign Het
Chd7 T C 4: 8,811,501 probably null Het
Cnih4 A G 1: 181,166,197 I76V probably null Het
Csmd2 G A 4: 128,442,840 V1404I probably benign Het
Ctrb1 T C 8: 111,689,403 D53G probably benign Het
Cul9 C A 17: 46,522,183 R1323L possibly damaging Het
Dchs1 A G 7: 105,763,503 V1230A possibly damaging Het
Dgat2 T C 7: 99,158,306 D219G probably benign Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dock9 G T 14: 121,586,264 A1412E probably benign Het
Dscam C T 16: 96,829,940 V292M probably damaging Het
Fam183b C T 11: 58,792,906 D113N probably damaging Het
Fras1 T A 5: 96,682,378 V1509E probably benign Het
Fryl T C 5: 73,068,803 Q1839R probably damaging Het
Gcat A G 15: 79,035,366 D177G probably damaging Het
Gss T C 2: 155,567,812 T235A possibly damaging Het
Ints10 T A 8: 68,797,798 M114K probably damaging Het
Ints5 T G 19: 8,897,386 L903R probably damaging Het
Lipo2 G T 19: 33,748,462 P130Q possibly damaging Het
Megf11 G A 9: 64,680,309 C494Y probably damaging Het
Milr1 T C 11: 106,763,921 Y162H probably damaging Het
Mrc2 T A 11: 105,328,418 I278N probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Myh15 G A 16: 49,069,403 C119Y probably damaging Het
Nap1l1 G A 10: 111,494,808 G358D probably damaging Het
Nav3 T C 10: 109,693,166 I2178V possibly damaging Het
Nkx2-5 T C 17: 26,841,294 E21G probably damaging Het
Olfr811 T C 10: 129,802,168 D119G probably damaging Het
Parp10 T C 15: 76,243,106 R44G probably damaging Het
Pced1b A G 15: 97,384,341 H87R probably damaging Het
Ppfia3 T A 7: 45,353,612 L524F probably damaging Het
Ppp1r12b T C 1: 134,886,438 T376A probably benign Het
Ppp4r4 T C 12: 103,590,852 L449P probably damaging Het
Prkd1 T C 12: 50,425,537 R198G probably damaging Het
Pth2r C A 1: 65,388,479 A437E probably benign Het
Ptprh A T 7: 4,601,865 I60N probably benign Het
Pxmp2 C T 5: 110,285,980 R9Q probably damaging Het
Scarb2 T C 5: 92,485,309 K55E probably benign Het
Slc18b1 T C 10: 23,804,234 V109A possibly damaging Het
Slx4ip T A 2: 137,000,210 D18E probably damaging Het
Stk40 A G 4: 126,123,814 R45G probably damaging Het
Tbxas1 A T 6: 39,084,306 Q513L probably damaging Het
Tcf4 A T 18: 69,657,650 probably null Het
Tmc6 T A 11: 117,774,317 I377F probably benign Het
Tmem131l T C 3: 83,961,631 I146V probably damaging Het
Trac T A 14: 54,220,592 probably benign Het
Trpm7 T C 2: 126,837,414 D409G probably damaging Het
Usp39 A T 6: 72,337,751 V224E possibly damaging Het
Vmn1r184 A C 7: 26,267,302 M158L probably benign Het
Vmn2r120 T A 17: 57,545,218 I33L probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACTTGTCTATCCTGAGCTGAGG -3'
(R):5'- TCCCTGGTCCTAGTTCCAAAGG -3'

Sequencing Primer
(F):5'- TGACTGAAGCCCTCAATGG -3'
(R):5'- AGTTCCAAAGGCTTGTGACC -3'
Posted On 2018-10-18