Mutagenetix > Incidental Mutation

Incidental Mutation 'R6868:Nos2'

536035

Institutional Source

Beutler Lab

Gene Symbol

Nos2

Ensembl Gene

ENSMUSG00000020826

Gene Name

nitric oxide synthase 2, inducible

Synonyms

iNOS, Nos-2, Nos2a, NOS-II

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6868 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78920787-78960254 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78957506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 967 (R967C)

Ref Sequence

ENSEMBL: ENSMUSP00000150558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]

AlphaFold

P29477

Predicted Effect

probably benign
Transcript: ENSMUST00000018610
AA Change: R1080C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: R1080C

Domain	Start	End	E-Value	Type
Pfam:NO_synthase	129	491	6.7e-189	PFAM
Pfam:Flavodoxin_1	535	666	5.5e-43	PFAM
Pfam:FAD_binding_1	719	941	8.8e-79	PFAM
Pfam:NAD_binding_1	973	1087	4.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214397
AA Change: R967C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	T	16: 14,618,695	N204I	probably damaging	Het
Aasdh	C	T	5: 76,891,680	V261M	probably damaging	Het
Adgrg7	A	G	16: 56,773,476	F126L	probably benign	Het
Agxt2	T	C	15: 10,373,769	L87P	probably damaging	Het
Alcam	G	A	16: 52,268,385	S554F	probably damaging	Het
Ambra1	T	C	2: 91,917,533	S1205P	possibly damaging	Het
Bst2	A	C	8: 71,534,760	V150G	unknown	Het
C3	T	C	17: 57,204,029	Y1659C	possibly damaging	Het
Cacna1s	G	A	1: 136,092,694	R823Q	probably benign	Het
Cdk4	T	C	10: 127,065,001	V174A	probably benign	Het
Ces2h	T	A	8: 105,018,423	N396K	probably benign	Het
Chd7	T	C	4: 8,811,501		probably null	Het
Cnih4	A	G	1: 181,166,197	I76V	probably null	Het
Csmd2	G	A	4: 128,442,840	V1404I	probably benign	Het
Ctrb1	T	C	8: 111,689,403	D53G	probably benign	Het
Cul9	C	A	17: 46,522,183	R1323L	possibly damaging	Het
Dchs1	A	G	7: 105,763,503	V1230A	possibly damaging	Het
Dgat2	T	C	7: 99,158,306	D219G	probably benign	Het
Dgkh	T	C	14: 78,624,853	T225A	probably damaging	Het
Dock9	G	T	14: 121,586,264	A1412E	probably benign	Het
Dscam	C	T	16: 96,829,940	V292M	probably damaging	Het
Fam183b	C	T	11: 58,792,906	D113N	probably damaging	Het
Fras1	T	A	5: 96,682,378	V1509E	probably benign	Het
Fryl	T	C	5: 73,068,803	Q1839R	probably damaging	Het
Gcat	A	G	15: 79,035,366	D177G	probably damaging	Het
Gss	T	C	2: 155,567,812	T235A	possibly damaging	Het
Ints10	T	A	8: 68,797,798	M114K	probably damaging	Het
Ints5	T	G	19: 8,897,386	L903R	probably damaging	Het
Lipo2	G	T	19: 33,748,462	P130Q	possibly damaging	Het
Megf11	G	A	9: 64,680,309	C494Y	probably damaging	Het
Milr1	T	C	11: 106,763,921	Y162H	probably damaging	Het
Mrc2	T	A	11: 105,328,418	I278N	probably damaging	Het
Mst1r	T	A	9: 107,915,933		probably null	Het
Myh15	G	A	16: 49,069,403	C119Y	probably damaging	Het
Nap1l1	G	A	10: 111,494,808	G358D	probably damaging	Het
Nav3	T	C	10: 109,693,166	I2178V	possibly damaging	Het
Nkx2-5	T	C	17: 26,841,294	E21G	probably damaging	Het
Olfr811	T	C	10: 129,802,168	D119G	probably damaging	Het
Parp10	T	C	15: 76,243,106	R44G	probably damaging	Het
Pced1b	A	G	15: 97,384,341	H87R	probably damaging	Het
Ppfia3	T	A	7: 45,353,612	L524F	probably damaging	Het
Ppp1r12b	T	C	1: 134,886,438	T376A	probably benign	Het
Ppp4r4	T	C	12: 103,590,852	L449P	probably damaging	Het
Prkd1	T	C	12: 50,425,537	R198G	probably damaging	Het
Pth2r	C	A	1: 65,388,479	A437E	probably benign	Het
Ptprh	A	T	7: 4,601,865	I60N	probably benign	Het
Pxmp2	C	T	5: 110,285,980	R9Q	probably damaging	Het
Scarb2	T	C	5: 92,485,309	K55E	probably benign	Het
Slc18b1	T	C	10: 23,804,234	V109A	possibly damaging	Het
Slx4ip	T	A	2: 137,000,210	D18E	probably damaging	Het
Stk40	A	G	4: 126,123,814	R45G	probably damaging	Het
Tbxas1	A	T	6: 39,084,306	Q513L	probably damaging	Het
Tcf4	A	T	18: 69,657,650		probably null	Het
Tmc6	T	A	11: 117,774,317	I377F	probably benign	Het
Tmem131l	T	C	3: 83,961,631	I146V	probably damaging	Het
Trac	T	A	14: 54,220,592		probably benign	Het
Trpm7	T	C	2: 126,837,414	D409G	probably damaging	Het
Usp39	A	T	6: 72,337,751	V224E	possibly damaging	Het
Vmn1r184	A	C	7: 26,267,302	M158L	probably benign	Het
Vmn2r120	T	A	17: 57,545,218	I33L	probably benign	Het

Other mutations in Nos2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Nos2	APN	11	78957452	missense	probably damaging	0.96
IGL01503:Nos2	APN	11	78945863	splice site	probably benign
IGL01789:Nos2	APN	11	78944657	splice site	probably benign
IGL02797:Nos2	APN	11	78940344	missense	probably damaging	1.00
IGL02968:Nos2	APN	11	78937637	missense	probably damaging	1.00
R6762_Nos2_754	UTSW	11	78959748	missense	possibly damaging	0.90
R0035:Nos2	UTSW	11	78945727	missense	probably damaging	1.00
R0265:Nos2	UTSW	11	78937602	missense	probably damaging	0.98
R0441:Nos2	UTSW	11	78928583	missense	probably benign	0.10
R0504:Nos2	UTSW	11	78940077	missense	probably damaging	1.00
R0570:Nos2	UTSW	11	78935361	missense	possibly damaging	0.49
R1356:Nos2	UTSW	11	78952803	missense	probably benign	0.00
R1538:Nos2	UTSW	11	78956570	missense	probably benign	0.00
R3414:Nos2	UTSW	11	78957588	missense	probably benign	0.14
R3418:Nos2	UTSW	11	78959695	missense	possibly damaging	0.47
R4279:Nos2	UTSW	11	78929776	missense	probably benign	0.01
R4492:Nos2	UTSW	11	78950095	missense	probably benign
R4632:Nos2	UTSW	11	78957591	missense	possibly damaging	0.95
R4686:Nos2	UTSW	11	78928630	missense	possibly damaging	0.65
R5038:Nos2	UTSW	11	78922314	missense	probably benign
R5214:Nos2	UTSW	11	78955441	missense	probably damaging	1.00
R5377:Nos2	UTSW	11	78957491	missense	probably benign	0.00
R5777:Nos2	UTSW	11	78940152	missense	probably null	1.00
R5834:Nos2	UTSW	11	78928579	missense	probably benign	0.01
R5930:Nos2	UTSW	11	78937915	missense	probably damaging	1.00
R6511:Nos2	UTSW	11	78955464	splice site	probably null
R6706:Nos2	UTSW	11	78944723	missense	possibly damaging	0.60
R6747:Nos2	UTSW	11	78952954	missense	probably damaging	0.99
R6762:Nos2	UTSW	11	78959748	missense	possibly damaging	0.90
R6817:Nos2	UTSW	11	78945266	missense	possibly damaging	0.64
R6917:Nos2	UTSW	11	78951227	missense	possibly damaging	0.50
R7082:Nos2	UTSW	11	78928579	missense	probably benign	0.02
R7286:Nos2	UTSW	11	78929854	missense	probably damaging	1.00
R7367:Nos2	UTSW	11	78950090	missense	possibly damaging	0.77
R7398:Nos2	UTSW	11	78936471	nonsense	probably null
R7411:Nos2	UTSW	11	78944855	critical splice donor site	probably null
R7469:Nos2	UTSW	11	78952971	missense	possibly damaging	0.94
R7736:Nos2	UTSW	11	78922366	nonsense	probably null
R8694:Nos2	UTSW	11	78945689	missense	possibly damaging	0.93
R8832:Nos2	UTSW	11	78955464	splice site	probably null
R8872:Nos2	UTSW	11	78949123	missense	probably damaging	0.99
R8952:Nos2	UTSW	11	78945263	missense	probably benign	0.00
R9433:Nos2	UTSW	11	78959664	missense	probably damaging	1.00
R9580:Nos2	UTSW	11	78937631	missense	probably benign	0.01
R9612:Nos2	UTSW	11	78949158	missense	probably damaging	1.00
R9727:Nos2	UTSW	11	78952999	missense	possibly damaging	0.51
R9747:Nos2	UTSW	11	78931646	missense	probably damaging	0.96
X0063:Nos2	UTSW	11	78922367	missense	probably benign	0.01
Z1177:Nos2	UTSW	11	78931672	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATACTTGTCTATCCTGAGCTGAGG -3'
(R):5'- TCCCTGGTCCTAGTTCCAAAGG -3'

Sequencing Primer
(F):5'- TGACTGAAGCCCTCAATGG -3'
(R):5'- AGTTCCAAAGGCTTGTGACC -3'

Posted On

2018-10-18