Incidental Mutation 'R6869:Chd6'
ID536066
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160965730 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1855 (S1855G)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably benign
Transcript: ENSMUST00000039782
AA Change: S1855G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: S1855G

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense probably damaging 1.00
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGTCCAGCAGTCTTG -3'
(R):5'- ATCTATCTCAAAAGAAGGGGAGCC -3'

Sequencing Primer
(F):5'- AGTCTTGCTCACCACCTCCAG -3'
(R):5'- CTGCTGCAGTGAGACAGGAC -3'
Posted On2018-10-18