Mutagenetix > Incidental Mutations

Incidental Mutation 'R6869:Chd6'

536066

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.773) question?

Stock #

R6869 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 160965730 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1855 (S1855G)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

Predicted Effect

probably benign
Transcript: ENSMUST00000039782
AA Change: S1855G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: S1855G

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankdd1b	A	T	13: 96,444,291	N166K	possibly damaging	Het
Arhgap30	G	T	1: 171,409,055	R999L	probably damaging	Het
Bnc2	T	A	4: 84,293,496	D212V	probably damaging	Het
Bpifb5	T	C	2: 154,233,223	I357T	probably benign	Het
Catsperb	T	C	12: 101,480,737	F208S	probably benign	Het
Cc2d2b	T	A	19: 40,809,454	H1105Q	probably benign	Het
Chchd6	T	C	6: 89,595,496	D17G	probably damaging	Het
Cpe	A	G	8: 64,619,427	V143A	probably benign	Het
Cyfip1	T	A	7: 55,907,365	V770D	possibly damaging	Het
Cyp1a1	A	T	9: 57,702,784	M494L	probably benign	Het
Dcstamp	T	C	15: 39,754,458	S88P	probably damaging	Het
Dnah2	T	A	11: 69,429,471	N3924I	probably damaging	Het
F830045P16Rik	T	C	2: 129,474,561	E76G	probably damaging	Het
Fam91a1	T	A	15: 58,431,268	V342E	probably benign	Het
Fastkd1	G	A	2: 69,702,760	A421V	probably benign	Het
Fgf20	T	C	8: 40,281,148	Y64C	probably damaging	Het
Gen1	A	T	12: 11,241,441	N847K	probably benign	Het
Gm438	A	T	4: 144,780,472		probably null	Het
Gm4922	A	T	10: 18,784,515	I153K	probably damaging	Het
Gm6619	T	C	6: 131,486,438	I6T	unknown	Het
H2-Ab1	T	C	17: 34,267,563	Y199H	probably damaging	Het
Hdac7	C	A	15: 97,796,176	L737F	probably damaging	Het
Hells	A	G	19: 38,940,635	N121D	probably benign	Het
Itga2	G	A	13: 114,875,537		probably null	Het
Itgb1	A	G	8: 128,720,035	D391G	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lbx1	T	A	19: 45,234,951	S93C	probably damaging	Het
Lmod2	T	C	6: 24,604,127	M367T	probably benign	Het
Lrrc43	G	A	5: 123,504,276		probably null	Het
Man2a2	C	T	7: 80,362,945	G574D	probably benign	Het
Mier2	T	G	10: 79,542,669	K343T	probably damaging	Het
Msh5	A	T	17: 35,041,834		probably null	Het
Mtus1	T	C	8: 41,082,654	Q675R	possibly damaging	Het
Ncan	A	T	8: 70,107,907	H803Q	probably benign	Het
Nckap5l	A	G	15: 99,426,453	V723A	probably damaging	Het
Nectin3	G	A	16: 46,395,143	R79C	probably damaging	Het
Nlrc5	A	G	8: 94,521,955	E1735G	probably benign	Het
Nrros	A	G	16: 32,144,431	L220S	probably damaging	Het
Olfr1107	T	A	2: 87,071,673	I154F	probably benign	Het
Olfr584	G	A	7: 103,085,868	V112M	possibly damaging	Het
Oxa1l	C	T	14: 54,366,738	P152S	probably damaging	Het
Pdcd6ip	A	G	9: 113,655,106	Y818H	unknown	Het
Pik3cb	A	T	9: 99,060,259	S682T	probably benign	Het
Ppp1r3a	A	C	6: 14,754,826	S141A	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Ptprk	T	C	10: 28,473,059		probably null	Het
Ranbp17	T	C	11: 33,513,074		probably benign	Het
Rcbtb1	T	C	14: 59,217,602	V95A	probably benign	Het
Retreg3	G	A	11: 101,119,818		probably benign	Het
Rhobtb1	T	C	10: 69,270,226	L207P	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Sh3bgr	A	G	16: 96,206,660	Y75C	probably damaging	Het
Strip1	T	C	3: 107,613,445	D763G	probably damaging	Het
Stxbp5l	A	T	16: 37,204,448	V596E	possibly damaging	Het
Tas2r138	A	G	6: 40,612,421	I297T	probably damaging	Het
Topors	A	C	4: 40,261,201	N694K	unknown	Het
Tymp	T	C	15: 89,376,691	R20G	probably benign	Het
Ubr4	A	G	4: 139,467,227	T1144A	possibly damaging	Het
Unc79	A	T	12: 103,113,072	Q1636L	probably benign	Het
Vmn1r78	A	G	7: 12,152,749	M96V	probably benign	Het
Wfdc8	C	T	2: 164,599,092	D244N	possibly damaging	Het
Zbtb49	G	T	5: 38,214,350	N62K	probably damaging	Het
Zfp579	G	T	7: 4,994,461	D150E	probably benign	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	161013154	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGTGGTCCAGCAGTCTTG -3'
(R):5'- ATCTATCTCAAAAGAAGGGGAGCC -3'

Sequencing Primer
(F):5'- AGTCTTGCTCACCACCTCCAG -3'
(R):5'- CTGCTGCAGTGAGACAGGAC -3'

Posted On

2018-10-18