Incidental Mutation 'R6869:Ppp1r3a'
ID 536076
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 044966-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6869 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 14754825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 141 (S141A)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: S141A

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: S141A

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 A T 4: 144,507,042 (GRCm39) probably null Het
Ankdd1b A T 13: 96,580,799 (GRCm39) N166K possibly damaging Het
Arhgap30 G T 1: 171,236,623 (GRCm39) R999L probably damaging Het
Bnc2 T A 4: 84,211,733 (GRCm39) D212V probably damaging Het
Bpifb5 T C 2: 154,075,143 (GRCm39) I357T probably benign Het
Catsperb T C 12: 101,446,996 (GRCm39) F208S probably benign Het
Cc2d2b T A 19: 40,797,898 (GRCm39) H1105Q probably benign Het
Chchd6 T C 6: 89,572,478 (GRCm39) D17G probably damaging Het
Chd6 T C 2: 160,807,650 (GRCm39) S1855G probably benign Het
Cpe A G 8: 65,072,461 (GRCm39) V143A probably benign Het
Cyfip1 T A 7: 55,557,113 (GRCm39) V770D possibly damaging Het
Cyp1a1 A T 9: 57,610,067 (GRCm39) M494L probably benign Het
Dcstamp T C 15: 39,617,854 (GRCm39) S88P probably damaging Het
Dnah2 T A 11: 69,320,297 (GRCm39) N3924I probably damaging Het
F830045P16Rik T C 2: 129,316,481 (GRCm39) E76G probably damaging Het
Fam91a1 T A 15: 58,303,117 (GRCm39) V342E probably benign Het
Fastkd1 G A 2: 69,533,104 (GRCm39) A421V probably benign Het
Fgf20 T C 8: 40,734,189 (GRCm39) Y64C probably damaging Het
Gen1 A T 12: 11,291,442 (GRCm39) N847K probably benign Het
Gm4922 A T 10: 18,660,263 (GRCm39) I153K probably damaging Het
Gm6619 T C 6: 131,463,401 (GRCm39) I6T unknown Het
H2-Ab1 T C 17: 34,486,537 (GRCm39) Y199H probably damaging Het
Hdac7 C A 15: 97,694,057 (GRCm39) L737F probably damaging Het
Hells A G 19: 38,929,079 (GRCm39) N121D probably benign Het
Itga2 G A 13: 115,012,073 (GRCm39) probably null Het
Itgb1 A G 8: 129,446,516 (GRCm39) D391G probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lbx1 T A 19: 45,223,390 (GRCm39) S93C probably damaging Het
Lmod2 T C 6: 24,604,126 (GRCm39) M367T probably benign Het
Lrrc43 G A 5: 123,642,339 (GRCm39) probably null Het
Man2a2 C T 7: 80,012,693 (GRCm39) G574D probably benign Het
Mier2 T G 10: 79,378,503 (GRCm39) K343T probably damaging Het
Msh5 A T 17: 35,260,810 (GRCm39) probably null Het
Mtus1 T C 8: 41,535,691 (GRCm39) Q675R possibly damaging Het
Ncan A T 8: 70,560,557 (GRCm39) H803Q probably benign Het
Nckap5l A G 15: 99,324,334 (GRCm39) V723A probably damaging Het
Nectin3 G A 16: 46,215,506 (GRCm39) R79C probably damaging Het
Nlrc5 A G 8: 95,248,583 (GRCm39) E1735G probably benign Het
Nrros A G 16: 31,963,249 (GRCm39) L220S probably damaging Het
Or52r1c G A 7: 102,735,075 (GRCm39) V112M possibly damaging Het
Or5aq1b T A 2: 86,902,017 (GRCm39) I154F probably benign Het
Oxa1l C T 14: 54,604,195 (GRCm39) P152S probably damaging Het
Pdcd6ip A G 9: 113,484,174 (GRCm39) Y818H unknown Het
Pik3cb A T 9: 98,942,312 (GRCm39) S682T probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,536,630 (GRCm39) probably benign Het
Ptprk T C 10: 28,349,055 (GRCm39) probably null Het
Ranbp17 T C 11: 33,463,074 (GRCm39) probably benign Het
Rcbtb1 T C 14: 59,455,051 (GRCm39) V95A probably benign Het
Retreg3 G A 11: 101,010,644 (GRCm39) probably benign Het
Rhobtb1 T C 10: 69,106,056 (GRCm39) L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,229,113 (GRCm39) probably benign Het
Sh3bgr A G 16: 96,007,860 (GRCm39) Y75C probably damaging Het
Strip1 T C 3: 107,520,761 (GRCm39) D763G probably damaging Het
Stxbp5l A T 16: 37,024,810 (GRCm39) V596E possibly damaging Het
Tas2r138 A G 6: 40,589,355 (GRCm39) I297T probably damaging Het
Topors A C 4: 40,261,201 (GRCm39) N694K unknown Het
Tymp T C 15: 89,260,894 (GRCm39) R20G probably benign Het
Ubr4 A G 4: 139,194,538 (GRCm39) T1144A possibly damaging Het
Unc79 A T 12: 103,079,331 (GRCm39) Q1636L probably benign Het
Vmn1r78 A G 7: 11,886,676 (GRCm39) M96V probably benign Het
Wfdc8 C T 2: 164,441,012 (GRCm39) D244N possibly damaging Het
Zbtb49 G T 5: 38,371,694 (GRCm39) N62K probably damaging Het
Zfp579 G T 7: 4,997,460 (GRCm39) D150E probably benign Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCAAAATGTGCCAGCAGAAG -3'
(R):5'- CTGGGATTCAGCCTTGTGTC -3'

Sequencing Primer
(F):5'- TGTGCCAGCAGAAGTTTCATAGC -3'
(R):5'- AGAATTTGATTGCTGGGAACTACC -3'
Posted On 2018-10-18