Mutagenetix > Incidental Mutations

Incidental Mutation 'R6869:Tas2r138'

536078

Institutional Source

Beutler Lab

Gene Symbol

Tas2r138

Ensembl Gene

ENSMUSG00000058250

Gene Name

taste receptor, type 2, member 138

Synonyms

mt2r31, T2R138, Tas2r38

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6869 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40612315-40613310 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40612421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 297 (I297T)

Ref Sequence

ENSEMBL: ENSMUSP00000075876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076565]

AlphaFold

Q7TQA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000076565
AA Change: I297T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: I297T

Domain	Start	End	E-Value	Type
Pfam:TAS2R	11	315	3.8e-64	PFAM

Meta Mutation Damage Score

0.8627

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankdd1b	A	T	13: 96,444,291	N166K	possibly damaging	Het
Arhgap30	G	T	1: 171,409,055	R999L	probably damaging	Het
Bnc2	T	A	4: 84,293,496	D212V	probably damaging	Het
Bpifb5	T	C	2: 154,233,223	I357T	probably benign	Het
Catsperb	T	C	12: 101,480,737	F208S	probably benign	Het
Cc2d2b	T	A	19: 40,809,454	H1105Q	probably benign	Het
Chchd6	T	C	6: 89,595,496	D17G	probably damaging	Het
Chd6	T	C	2: 160,965,730	S1855G	probably benign	Het
Cpe	A	G	8: 64,619,427	V143A	probably benign	Het
Cyfip1	T	A	7: 55,907,365	V770D	possibly damaging	Het
Cyp1a1	A	T	9: 57,702,784	M494L	probably benign	Het
Dcstamp	T	C	15: 39,754,458	S88P	probably damaging	Het
Dnah2	T	A	11: 69,429,471	N3924I	probably damaging	Het
F830045P16Rik	T	C	2: 129,474,561	E76G	probably damaging	Het
Fam91a1	T	A	15: 58,431,268	V342E	probably benign	Het
Fastkd1	G	A	2: 69,702,760	A421V	probably benign	Het
Fgf20	T	C	8: 40,281,148	Y64C	probably damaging	Het
Gen1	A	T	12: 11,241,441	N847K	probably benign	Het
Gm438	A	T	4: 144,780,472		probably null	Het
Gm4922	A	T	10: 18,784,515	I153K	probably damaging	Het
Gm6619	T	C	6: 131,486,438	I6T	unknown	Het
H2-Ab1	T	C	17: 34,267,563	Y199H	probably damaging	Het
Hdac7	C	A	15: 97,796,176	L737F	probably damaging	Het
Hells	A	G	19: 38,940,635	N121D	probably benign	Het
Itga2	G	A	13: 114,875,537		probably null	Het
Itgb1	A	G	8: 128,720,035	D391G	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lbx1	T	A	19: 45,234,951	S93C	probably damaging	Het
Lmod2	T	C	6: 24,604,127	M367T	probably benign	Het
Lrrc43	G	A	5: 123,504,276		probably null	Het
Man2a2	C	T	7: 80,362,945	G574D	probably benign	Het
Mier2	T	G	10: 79,542,669	K343T	probably damaging	Het
Msh5	A	T	17: 35,041,834		probably null	Het
Mtus1	T	C	8: 41,082,654	Q675R	possibly damaging	Het
Ncan	A	T	8: 70,107,907	H803Q	probably benign	Het
Nckap5l	A	G	15: 99,426,453	V723A	probably damaging	Het
Nectin3	G	A	16: 46,395,143	R79C	probably damaging	Het
Nlrc5	A	G	8: 94,521,955	E1735G	probably benign	Het
Nrros	A	G	16: 32,144,431	L220S	probably damaging	Het
Olfr1107	T	A	2: 87,071,673	I154F	probably benign	Het
Olfr584	G	A	7: 103,085,868	V112M	possibly damaging	Het
Oxa1l	C	T	14: 54,366,738	P152S	probably damaging	Het
Pdcd6ip	A	G	9: 113,655,106	Y818H	unknown	Het
Pik3cb	A	T	9: 99,060,259	S682T	probably benign	Het
Ppp1r3a	A	C	6: 14,754,826	S141A	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Ptprk	T	C	10: 28,473,059		probably null	Het
Ranbp17	T	C	11: 33,513,074		probably benign	Het
Rcbtb1	T	C	14: 59,217,602	V95A	probably benign	Het
Retreg3	G	A	11: 101,119,818		probably benign	Het
Rhobtb1	T	C	10: 69,270,226	L207P	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Sh3bgr	A	G	16: 96,206,660	Y75C	probably damaging	Het
Strip1	T	C	3: 107,613,445	D763G	probably damaging	Het
Stxbp5l	A	T	16: 37,204,448	V596E	possibly damaging	Het
Topors	A	C	4: 40,261,201	N694K	unknown	Het
Tymp	T	C	15: 89,376,691	R20G	probably benign	Het
Ubr4	A	G	4: 139,467,227	T1144A	possibly damaging	Het
Unc79	A	T	12: 103,113,072	Q1636L	probably benign	Het
Vmn1r78	A	G	7: 12,152,749	M96V	probably benign	Het
Wfdc8	C	T	2: 164,599,092	D244N	possibly damaging	Het
Zbtb49	G	T	5: 38,214,350	N62K	probably damaging	Het
Zfp579	G	T	7: 4,994,461	D150E	probably benign	Het

Other mutations in Tas2r138

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00550:Tas2r138	APN	6	40612586	missense	probably benign	0.07
IGL01468:Tas2r138	APN	6	40612476	missense	probably benign	0.22
IGL02626:Tas2r138	APN	6	40612715	missense	possibly damaging	0.61
IGL03008:Tas2r138	APN	6	40613182	missense	probably damaging	1.00
R0595:Tas2r138	UTSW	6	40612865	missense	probably damaging	1.00
R2845:Tas2r138	UTSW	6	40612767	missense	probably benign	0.09
R2975:Tas2r138	UTSW	6	40613264	missense	probably benign	0.00
R4202:Tas2r138	UTSW	6	40612476	missense	possibly damaging	0.95
R4923:Tas2r138	UTSW	6	40612886	missense	possibly damaging	0.82
R5526:Tas2r138	UTSW	6	40612980	missense	probably benign	0.00
R6647:Tas2r138	UTSW	6	40612799	missense	possibly damaging	0.91
R8781:Tas2r138	UTSW	6	40612916	missense	probably benign	0.00
R8786:Tas2r138	UTSW	6	40612677	missense	probably damaging	1.00
R9200:Tas2r138	UTSW	6	40612560	missense	probably damaging	1.00
R9258:Tas2r138	UTSW	6	40613195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGACATCAAGGAGAACGGATTC -3'
(R):5'- AGTGCTGGTTATCTCCCTGG -3'

Sequencing Primer
(F):5'- TTATCAGAGTGTCCTGGG -3'
(R):5'- TCCCTGGGGAGTCACATGAG -3'

Posted On

2018-10-18