Incidental Mutation 'R6869:Vmn1r78'
ID536081
Institutional Source Beutler Lab
Gene Symbol Vmn1r78
Ensembl Gene ENSMUSG00000061602
Gene Namevomeronasal 1 receptor 78
SynonymsV1rg7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6869 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12150257-12159959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12152749 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 96 (M96V)
Ref Sequence ENSEMBL: ENSMUSP00000154797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078039] [ENSMUST00000228244] [ENSMUST00000228664]
Predicted Effect probably benign
Transcript: ENSMUST00000078039
AA Change: M96V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077186
Gene: ENSMUSG00000061602
AA Change: M96V

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 5.7e-8 PFAM
Pfam:V1R 12 301 1.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228244
AA Change: M96V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228664
AA Change: M96V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Vmn1r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Vmn1r78 APN 7 12153238 missense probably benign 0.10
IGL02019:Vmn1r78 APN 7 12152707 missense probably damaging 0.99
IGL02143:Vmn1r78 APN 7 12152480 missense probably benign
IGL02154:Vmn1r78 APN 7 12152545 missense probably benign 0.22
IGL02290:Vmn1r78 APN 7 12153155 missense probably damaging 1.00
IGL03012:Vmn1r78 APN 7 12153364 missense probably benign 0.32
IGL03256:Vmn1r78 APN 7 12152798 missense probably damaging 1.00
IGL03373:Vmn1r78 APN 7 12153343 missense possibly damaging 0.86
IGL03384:Vmn1r78 APN 7 12153209 missense possibly damaging 0.94
R0016:Vmn1r78 UTSW 7 12153352 missense probably benign 0.02
R1445:Vmn1r78 UTSW 7 12152581 missense possibly damaging 0.64
R1748:Vmn1r78 UTSW 7 12153323 missense probably damaging 1.00
R2017:Vmn1r78 UTSW 7 12153343 missense possibly damaging 0.86
R2032:Vmn1r78 UTSW 7 12153283 missense probably benign 0.00
R2198:Vmn1r78 UTSW 7 12152560 missense probably benign 0.06
R4330:Vmn1r78 UTSW 7 12152459 unclassified probably null
R4564:Vmn1r78 UTSW 7 12152558 missense probably damaging 1.00
R4769:Vmn1r78 UTSW 7 12152798 missense probably damaging 1.00
R4801:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4802:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R5648:Vmn1r78 UTSW 7 12152766 missense possibly damaging 0.92
R6561:Vmn1r78 UTSW 7 12152899 missense probably damaging 1.00
R6945:Vmn1r78 UTSW 7 12152905 missense probably benign 0.01
Z1088:Vmn1r78 UTSW 7 12152714 missense probably damaging 1.00
Predicted Primers
Posted On2018-10-18