Incidental Mutation 'R6869:Fgf20'
ID536086
Institutional Source Beutler Lab
Gene Symbol Fgf20
Ensembl Gene ENSMUSG00000031603
Gene Namefibroblast growth factor 20
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40279166-40308331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40281148 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 64 (Y64C)
Ref Sequence ENSEMBL: ENSMUSP00000112756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034014] [ENSMUST00000118639]
Predicted Effect probably damaging
Transcript: ENSMUST00000034014
AA Change: Y118C

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034014
Gene: ENSMUSG00000031603
AA Change: Y118C

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
FGF 63 194 3.3e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118639
AA Change: Y64C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112756
Gene: ENSMUSG00000031603
AA Change: Y64C

DomainStartEndE-ValueType
FGF 6 140 2.08e-47 SMART
Meta Mutation Damage Score 0.7865 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor family. The fibroblast growth factors possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene product is a secreted neurotrophic factor but lacks a typical signal peptide. It is expressed in normal brain, particularly the cerebellum, and may regulate central nervous system development and function. Homodimerization of this protein was shown to regulate its receptor binding activity and concentration gradient in the extracellular matrix. Genetic variations of this gene have been associated with Parkinson disease susceptibility. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired coclear lateral compartment differentiation and deafness without loss of vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Fgf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Fgf20 APN 8 40279787 missense probably damaging 0.99
IGL03365:Fgf20 APN 8 40279891 missense possibly damaging 0.95
mermaid UTSW 8 40281148 missense probably damaging 0.98
LCD18:Fgf20 UTSW 8 40292318 intron probably benign
R1893:Fgf20 UTSW 8 40279803 missense possibly damaging 0.49
R4067:Fgf20 UTSW 8 40279855 missense probably benign 0.00
R4613:Fgf20 UTSW 8 40286611 missense probably benign
R6166:Fgf20 UTSW 8 40279840 missense probably damaging 0.98
R6280:Fgf20 UTSW 8 40281112 nonsense probably null
R7561:Fgf20 UTSW 8 40279934 missense possibly damaging 0.92
R7739:Fgf20 UTSW 8 40279896 missense probably damaging 1.00
R8191:Fgf20 UTSW 8 40308320 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTGCAATTGTAGCAATATTGG -3'
(R):5'- CCTGTTGTGATGATAGCGTCC -3'

Sequencing Primer
(F):5'- TCTGTTATGTCAGCTACATG -3'
(R):5'- TGTGATGATAGCGTCCATTTATTTG -3'
Posted On2018-10-18