Mutagenetix > Incidental Mutation

Incidental Mutation 'R6869:Ncan'

536089

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6869 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70107907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 803 (H803Q)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002412
AA Change: H803Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: H803Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankdd1b	A	T	13: 96,444,291	N166K	possibly damaging	Het
Arhgap30	G	T	1: 171,409,055	R999L	probably damaging	Het
Bnc2	T	A	4: 84,293,496	D212V	probably damaging	Het
Bpifb5	T	C	2: 154,233,223	I357T	probably benign	Het
Catsperb	T	C	12: 101,480,737	F208S	probably benign	Het
Cc2d2b	T	A	19: 40,809,454	H1105Q	probably benign	Het
Chchd6	T	C	6: 89,595,496	D17G	probably damaging	Het
Chd6	T	C	2: 160,965,730	S1855G	probably benign	Het
Cpe	A	G	8: 64,619,427	V143A	probably benign	Het
Cyfip1	T	A	7: 55,907,365	V770D	possibly damaging	Het
Cyp1a1	A	T	9: 57,702,784	M494L	probably benign	Het
Dcstamp	T	C	15: 39,754,458	S88P	probably damaging	Het
Dnah2	T	A	11: 69,429,471	N3924I	probably damaging	Het
F830045P16Rik	T	C	2: 129,474,561	E76G	probably damaging	Het
Fam91a1	T	A	15: 58,431,268	V342E	probably benign	Het
Fastkd1	G	A	2: 69,702,760	A421V	probably benign	Het
Fgf20	T	C	8: 40,281,148	Y64C	probably damaging	Het
Gen1	A	T	12: 11,241,441	N847K	probably benign	Het
Gm438	A	T	4: 144,780,472		probably null	Het
Gm4922	A	T	10: 18,784,515	I153K	probably damaging	Het
Gm6619	T	C	6: 131,486,438	I6T	unknown	Het
H2-Ab1	T	C	17: 34,267,563	Y199H	probably damaging	Het
Hdac7	C	A	15: 97,796,176	L737F	probably damaging	Het
Hells	A	G	19: 38,940,635	N121D	probably benign	Het
Itga2	G	A	13: 114,875,537		probably null	Het
Itgb1	A	G	8: 128,720,035	D391G	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lbx1	T	A	19: 45,234,951	S93C	probably damaging	Het
Lmod2	T	C	6: 24,604,127	M367T	probably benign	Het
Lrrc43	G	A	5: 123,504,276		probably null	Het
Man2a2	C	T	7: 80,362,945	G574D	probably benign	Het
Mier2	T	G	10: 79,542,669	K343T	probably damaging	Het
Msh5	A	T	17: 35,041,834		probably null	Het
Mtus1	T	C	8: 41,082,654	Q675R	possibly damaging	Het
Nckap5l	A	G	15: 99,426,453	V723A	probably damaging	Het
Nectin3	G	A	16: 46,395,143	R79C	probably damaging	Het
Nlrc5	A	G	8: 94,521,955	E1735G	probably benign	Het
Nrros	A	G	16: 32,144,431	L220S	probably damaging	Het
Olfr1107	T	A	2: 87,071,673	I154F	probably benign	Het
Olfr584	G	A	7: 103,085,868	V112M	possibly damaging	Het
Oxa1l	C	T	14: 54,366,738	P152S	probably damaging	Het
Pdcd6ip	A	G	9: 113,655,106	Y818H	unknown	Het
Pik3cb	A	T	9: 99,060,259	S682T	probably benign	Het
Ppp1r3a	A	C	6: 14,754,826	S141A	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Ptprk	T	C	10: 28,473,059		probably null	Het
Ranbp17	T	C	11: 33,513,074		probably benign	Het
Rcbtb1	T	C	14: 59,217,602	V95A	probably benign	Het
Retreg3	G	A	11: 101,119,818		probably benign	Het
Rhobtb1	T	C	10: 69,270,226	L207P	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Sh3bgr	A	G	16: 96,206,660	Y75C	probably damaging	Het
Strip1	T	C	3: 107,613,445	D763G	probably damaging	Het
Stxbp5l	A	T	16: 37,204,448	V596E	possibly damaging	Het
Tas2r138	A	G	6: 40,612,421	I297T	probably damaging	Het
Topors	A	C	4: 40,261,201	N694K	unknown	Het
Tymp	T	C	15: 89,376,691	R20G	probably benign	Het
Ubr4	A	G	4: 139,467,227	T1144A	possibly damaging	Het
Unc79	A	T	12: 103,113,072	Q1636L	probably benign	Het
Vmn1r78	A	G	7: 12,152,749	M96V	probably benign	Het
Wfdc8	C	T	2: 164,599,092	D244N	possibly damaging	Het
Zbtb49	G	T	5: 38,214,350	N62K	probably damaging	Het
Zfp579	G	T	7: 4,994,461	D150E	probably benign	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGAGAGGCTCCAGTGACTC -3'
(R):5'- GATGAATCCTGTCCCTTCTGATG -3'

Sequencing Primer
(F):5'- CCACCATCTGGCCCTTAGG -3'
(R):5'- ATGCTGGCATCCTAGGGACTG -3'

Posted On

2018-10-18