Mutagenetix > Incidental Mutations

Incidental Mutation 'R6869:Itga2'

536106

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

VLA-2 receptor, alpha 2 subunit, DX5, CD49B

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6869 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114833081-114932100 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 114875537 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

Predicted Effect

probably null
Transcript: ENSMUST00000056117

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (61/63)

MGI Phenotype

Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankdd1b	A	T	13: 96,444,291	N166K	possibly damaging	Het
Arhgap30	G	T	1: 171,409,055	R999L	probably damaging	Het
Bnc2	T	A	4: 84,293,496	D212V	probably damaging	Het
Bpifb5	T	C	2: 154,233,223	I357T	probably benign	Het
Catsperb	T	C	12: 101,480,737	F208S	probably benign	Het
Cc2d2b	T	A	19: 40,809,454	H1105Q	probably benign	Het
Chchd6	T	C	6: 89,595,496	D17G	probably damaging	Het
Chd6	T	C	2: 160,965,730	S1855G	probably benign	Het
Cpe	A	G	8: 64,619,427	V143A	probably benign	Het
Cyfip1	T	A	7: 55,907,365	V770D	possibly damaging	Het
Cyp1a1	A	T	9: 57,702,784	M494L	probably benign	Het
Dcstamp	T	C	15: 39,754,458	S88P	probably damaging	Het
Dnah2	T	A	11: 69,429,471	N3924I	probably damaging	Het
F830045P16Rik	T	C	2: 129,474,561	E76G	probably damaging	Het
Fam91a1	T	A	15: 58,431,268	V342E	probably benign	Het
Fastkd1	G	A	2: 69,702,760	A421V	probably benign	Het
Fgf20	T	C	8: 40,281,148	Y64C	probably damaging	Het
Gen1	A	T	12: 11,241,441	N847K	probably benign	Het
Gm438	A	T	4: 144,780,472		probably null	Het
Gm4922	A	T	10: 18,784,515	I153K	probably damaging	Het
Gm6619	T	C	6: 131,486,438	I6T	unknown	Het
H2-Ab1	T	C	17: 34,267,563	Y199H	probably damaging	Het
Hdac7	C	A	15: 97,796,176	L737F	probably damaging	Het
Hells	A	G	19: 38,940,635	N121D	probably benign	Het
Itgb1	A	G	8: 128,720,035	D391G	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lbx1	T	A	19: 45,234,951	S93C	probably damaging	Het
Lmod2	T	C	6: 24,604,127	M367T	probably benign	Het
Lrrc43	G	A	5: 123,504,276		probably null	Het
Man2a2	C	T	7: 80,362,945	G574D	probably benign	Het
Mier2	T	G	10: 79,542,669	K343T	probably damaging	Het
Msh5	A	T	17: 35,041,834		probably null	Het
Mtus1	T	C	8: 41,082,654	Q675R	possibly damaging	Het
Ncan	A	T	8: 70,107,907	H803Q	probably benign	Het
Nckap5l	A	G	15: 99,426,453	V723A	probably damaging	Het
Nectin3	G	A	16: 46,395,143	R79C	probably damaging	Het
Nlrc5	A	G	8: 94,521,955	E1735G	probably benign	Het
Nrros	A	G	16: 32,144,431	L220S	probably damaging	Het
Olfr1107	T	A	2: 87,071,673	I154F	probably benign	Het
Olfr584	G	A	7: 103,085,868	V112M	possibly damaging	Het
Oxa1l	C	T	14: 54,366,738	P152S	probably damaging	Het
Pdcd6ip	A	G	9: 113,655,106	Y818H	unknown	Het
Pik3cb	A	T	9: 99,060,259	S682T	probably benign	Het
Ppp1r3a	A	C	6: 14,754,826	S141A	probably benign	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Ptprk	T	C	10: 28,473,059		probably null	Het
Ranbp17	T	C	11: 33,513,074		probably benign	Het
Rcbtb1	T	C	14: 59,217,602	V95A	probably benign	Het
Retreg3	G	A	11: 101,119,818		probably benign	Het
Rhobtb1	T	C	10: 69,270,226	L207P	probably damaging	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Sh3bgr	A	G	16: 96,206,660	Y75C	probably damaging	Het
Strip1	T	C	3: 107,613,445	D763G	probably damaging	Het
Stxbp5l	A	T	16: 37,204,448	V596E	possibly damaging	Het
Tas2r138	A	G	6: 40,612,421	I297T	probably damaging	Het
Topors	A	C	4: 40,261,201	N694K	unknown	Het
Tymp	T	C	15: 89,376,691	R20G	probably benign	Het
Ubr4	A	G	4: 139,467,227	T1144A	possibly damaging	Het
Unc79	A	T	12: 103,113,072	Q1636L	probably benign	Het
Vmn1r78	A	G	7: 12,152,749	M96V	probably benign	Het
Wfdc8	C	T	2: 164,599,092	D244N	possibly damaging	Het
Zbtb49	G	T	5: 38,214,350	N62K	probably damaging	Het
Zfp579	G	T	7: 4,994,461	D150E	probably benign	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	114877625	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114859632	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114837091	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114854411	splice site	probably benign
IGL01965:Itga2	APN	13	114848064	splice site	probably benign
IGL01987:Itga2	APN	13	114847946	nonsense	probably null
IGL02334:Itga2	APN	13	114865309	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114856722	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114836570	unclassified	probably benign
IGL03191:Itga2	APN	13	114836484	unclassified	probably benign
IGL03209:Itga2	APN	13	114880632	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	114866199	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114836579	unclassified	probably benign
R0152:Itga2	UTSW	13	114866314	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114853899	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114845856	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114856650	splice site	probably benign
R0688:Itga2	UTSW	13	114839554	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114862375	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114859632	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114856679	missense	probably damaging	0.99
R1196:Itga2	UTSW	13	114866155	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114849420	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114857296	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114856726	missense	probably damaging	0.98
R1834:Itga2	UTSW	13	114856727	missense	probably damaging	1.00
R2180:Itga2	UTSW	13	114849381	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	114870605	missense	probably benign	0.05
R2518:Itga2	UTSW	13	114881042	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	114869299	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114839518	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	114870625	missense	probably benign	0.01
R4193:Itga2	UTSW	13	114886649	nonsense	probably null
R4290:Itga2	UTSW	13	114866173	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	114877693	missense	probably benign	0.03
R4655:Itga2	UTSW	13	114873269	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114857373	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114853766	nonsense	probably null
R5093:Itga2	UTSW	13	114856181	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	114884506	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114839570	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	114868206	missense	probably benign	0.02
R5923:Itga2	UTSW	13	114884519	missense	probably benign	0.02
R6163:Itga2	UTSW	13	114866190	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114839561	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114845888	missense	probably benign	0.05
R6283:Itga2	UTSW	13	114869250	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114843473	missense	probably benign
R6510:Itga2	UTSW	13	114873280	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114836525	missense	possibly damaging	0.93
R7073:Itga2	UTSW	13	114859613	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	114900530	missense	unknown
R7236:Itga2	UTSW	13	114877691	missense	probably benign
R7269:Itga2	UTSW	13	114886689	nonsense	probably null
R7296:Itga2	UTSW	13	114857394	splice site	probably null
R7350:Itga2	UTSW	13	114837202	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	114869217	missense	probably benign	0.06
R7501:Itga2	UTSW	13	114875559	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	114866260	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114853891	missense	probably benign
R7810:Itga2	UTSW	13	114866179	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114853755	missense	probably damaging	1.00
Z1088:Itga2	UTSW	13	114857332	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114853701	critical splice donor site	probably null

Predicted Primers

Posted On

2018-10-18