Incidental Mutation 'R6869:Fam91a1'
ID536110
Institutional Source Beutler Lab
Gene Symbol Fam91a1
Ensembl Gene ENSMUSG00000037119
Gene Namefamily with sequence similarity 91, member A1
SynonymsD15Ertd621e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6869 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58415468-58457740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58431268 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 342 (V342E)
Ref Sequence ENSEMBL: ENSMUSP00000036524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037270]
Predicted Effect probably benign
Transcript: ENSMUST00000037270
AA Change: V342E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036524
Gene: ENSMUSG00000037119
AA Change: V342E

DomainStartEndE-ValueType
Pfam:FAM91_N 8 312 2.8e-149 PFAM
Pfam:FAM91_C 374 821 3.8e-182 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chchd6 T C 6: 89,595,496 D17G probably damaging Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Msh5 A T 17: 35,041,834 probably null Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Ranbp17 T C 11: 33,513,074 probably benign Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Fam91a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fam91a1 APN 15 58430735 missense probably damaging 0.99
IGL00590:Fam91a1 APN 15 58415716 missense possibly damaging 0.66
IGL01301:Fam91a1 APN 15 58442871 missense probably damaging 0.99
IGL01372:Fam91a1 APN 15 58430062 missense probably damaging 1.00
IGL01979:Fam91a1 APN 15 58432584 missense probably damaging 1.00
IGL02085:Fam91a1 APN 15 58441656 missense possibly damaging 0.95
IGL02553:Fam91a1 APN 15 58432982 critical splice donor site probably null
IGL02605:Fam91a1 APN 15 58431196 splice site probably benign
IGL02882:Fam91a1 APN 15 58453061 splice site probably benign
IGL02894:Fam91a1 APN 15 58443231 missense probably benign 0.09
ANU18:Fam91a1 UTSW 15 58442871 missense probably damaging 0.99
H8562:Fam91a1 UTSW 15 58427121 splice site probably null
R0395:Fam91a1 UTSW 15 58454792 missense probably benign
R1165:Fam91a1 UTSW 15 58430669 missense possibly damaging 0.90
R1699:Fam91a1 UTSW 15 58432948 missense probably benign 0.04
R1749:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R1997:Fam91a1 UTSW 15 58424195 critical splice acceptor site probably null
R2042:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R2188:Fam91a1 UTSW 15 58430663 missense probably damaging 0.98
R2518:Fam91a1 UTSW 15 58450600 missense possibly damaging 0.92
R3124:Fam91a1 UTSW 15 58421889 missense probably benign 0.34
R3916:Fam91a1 UTSW 15 58430734 missense probably damaging 1.00
R4810:Fam91a1 UTSW 15 58434740 missense probably damaging 1.00
R4959:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R4973:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R5288:Fam91a1 UTSW 15 58448394 missense probably benign
R5385:Fam91a1 UTSW 15 58448394 missense probably benign
R5386:Fam91a1 UTSW 15 58448394 missense probably benign
R5941:Fam91a1 UTSW 15 58431317 missense probably benign 0.01
R6415:Fam91a1 UTSW 15 58442917 missense probably damaging 1.00
R7175:Fam91a1 UTSW 15 58430678 missense probably benign 0.06
R7872:Fam91a1 UTSW 15 58448360 missense probably benign 0.01
X0024:Fam91a1 UTSW 15 58430189 missense probably damaging 0.98
Z1177:Fam91a1 UTSW 15 58432548 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAGAGCAGATTGAGAACTCGTC -3'
(R):5'- TGGTAAGGACTCAGACTGCAC -3'

Sequencing Primer
(F):5'- AGAACTCGTCTCAGTCTCAGATGTG -3'
(R):5'- TCAGACTGCACACCACATAGG -3'
Posted On2018-10-18