Mutagenetix > Incidental Mutations

Incidental Mutation 'R6870:Arhgap21'

536123

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R6870 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20880510 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 619 (S619P)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114594
AA Change: S623P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: S623P

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141298
AA Change: S629P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: S629P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154230
AA Change: S629P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: S629P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173194
AA Change: S619P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: S619P

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174584
AA Change: S458P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: S458P

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

72% (39/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,136,408	Y62C	probably benign	Het
A1bg	T	C	15: 60,919,715	T291A	probably damaging	Het
Abcb11	A	G	2: 69,285,298	I574T	possibly damaging	Het
Abcb5	T	A	12: 118,965,265	Y17F	possibly damaging	Het
Arfgef3	A	T	10: 18,646,730	L516*	probably null	Het
Atp2c1	A	G	9: 105,470,062	V65A	probably benign	Het
Calm3	T	A	7: 16,919,643	Q9L	probably benign	Het
Cd300c2	C	T	11: 115,000,677	D124N	probably damaging	Het
Celsr3	A	G	9: 108,829,191	T958A	probably benign	Het
Cfap69	T	C	5: 5,621,958	T317A	probably benign	Het
Cluh	T	A	11: 74,665,384	I887K	probably damaging	Het
Dag1	A	T	9: 108,209,258	V228E	probably damaging	Het
Dhtkd1	T	C	2: 5,919,437		probably null	Het
Dnah1	T	A	14: 31,271,061	K2959*	probably null	Het
Dnttip2	T	A	3: 122,275,808	V224E	probably damaging	Het
Drosha	C	T	15: 12,907,393	P1071L	probably benign	Het
E030025P04Rik	T	A	11: 109,140,167	H84L	unknown	Het
Elac2	A	T	11: 64,999,763	S698C	probably null	Het
Elf2	A	T	3: 51,294,165	*88R	probably null	Het
Fastkd1	T	A	2: 69,708,614	I143L	probably benign	Het
Fbxw10	C	T	11: 62,855,367	R366C	probably damaging	Het
Frg2f1	T	C	4: 119,531,132	M57V	probably benign	Het
Gbp4	T	C	5: 105,125,578	S129G	probably damaging	Het
Gnat2	A	C	3: 108,095,631		probably benign	Het
Golgb1	C	A	16: 36,918,203	F2301L	probably damaging	Het
Il18bp	T	C	7: 102,017,311	T2A	possibly damaging	Het
Kpna2	T	C	11: 106,992,694		probably null	Het
Lrrfip2	A	T	9: 111,216,119		probably benign	Het
Map4k1	T	G	7: 29,001,671		probably null	Het
Mcm3ap	T	C	10: 76,470,215	V54A	probably benign	Het
Nup133	A	G	8: 123,899,507	I1112T	probably benign	Het
Olfr906	A	C	9: 38,488,086	D19A	probably benign	Het
Pcdhac1	T	A	18: 37,092,087	V651D	probably damaging	Het
Pde10a	A	G	17: 8,967,524	T571A	possibly damaging	Het
Phc3	A	G	3: 30,936,761	S403P	probably damaging	Het
Prl7b1	T	C	13: 27,604,533	E113G	probably damaging	Het
Psmd2	T	G	16: 20,661,843	M744R	probably benign	Het
Qrich2	T	C	11: 116,455,330	D1556G	probably damaging	Het
Sept1	C	T	7: 127,217,704	V46M	probably benign	Het
Shank2	C	A	7: 144,052,460	Q127K	probably damaging	Het
Siah1a	A	G	8: 86,725,025	V277A	possibly damaging	Het
Slc4a7	T	A	14: 14,733,846	D85E	probably damaging	Het
Slc5a12	A	T	2: 110,641,810	I526F	probably damaging	Het
Svil	T	C	18: 5,063,231	V834A	possibly damaging	Het
Sycp1	T	A	3: 102,935,603	S17C	probably damaging	Het
Tmem2	T	C	19: 21,832,123	S956P	possibly damaging	Het
Tssk6	G	A	8: 69,903,023	R239Q	probably benign	Het
Txnrd1	A	G	10: 82,873,208	D80G	probably benign	Het
Tyk2	A	G	9: 21,124,954	F79S	probably damaging	Het
Tyrp1	T	C	4: 80,850,777	S503P	probably benign	Het
Upf1	A	T	8: 70,341,561	C232S	probably benign	Het
Zeb2	G	A	2: 44,988,910	T1080I	probably damaging	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20865387	missense	probably benign
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGCAGAAGTTCCTGGTAGACAC -3'
(R):5'- CAAATTTGACTGTGGCTCCCG -3'

Sequencing Primer
(F):5'- CTGGTAGACACGAGGATACCTC -3'
(R):5'- CCCGTTGTTAATTCTGATAACAGGCG -3'

Posted On

2018-10-18