Incidental Mutation 'R6870:Slc5a12'
ID536127
Institutional Source Beutler Lab
Gene Symbol Slc5a12
Ensembl Gene ENSMUSG00000041644
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 12
SynonymsSMCT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location110597298-110647779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110641810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 526 (I526F)
Ref Sequence ENSEMBL: ENSMUSP00000047340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045972] [ENSMUST00000111026]
Predicted Effect probably damaging
Transcript: ENSMUST00000045972
AA Change: I526F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047340
Gene: ENSMUSG00000041644
AA Change: I526F

DomainStartEndE-ValueType
Pfam:SSF 41 449 6.5e-43 PFAM
transmembrane domain 507 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111026
AA Change: I522F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106655
Gene: ENSMUSG00000041644
AA Change: I522F

DomainStartEndE-ValueType
Pfam:SSF 41 445 6.2e-48 PFAM
transmembrane domain 503 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Normal blood lactate is maintained at about 1.5 mM, and little filtered lactate is excreted in urine. Reabsorption of lactate is mediated by the low-affinity Na(+)-coupled lactate transporter SLC5A12 in the initial part of the proximal tubule and by the high-affinity Na(+)-coupled lactate transporter SLC5A8 (MIM 608044) in the distal proximal tubule (Gopal et al., 2007 [PubMed 17692818]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Slc5a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc5a12 APN 2 110597822 missense probably damaging 1.00
IGL01337:Slc5a12 APN 2 110620373 nonsense probably null
IGL01830:Slc5a12 APN 2 110597806 missense probably damaging 1.00
IGL02456:Slc5a12 APN 2 110616834 splice site probably benign
IGL02619:Slc5a12 APN 2 110640856 missense probably benign 0.00
IGL02832:Slc5a12 APN 2 110640815 missense probably benign
IGL02890:Slc5a12 APN 2 110624133 splice site probably benign
IGL03058:Slc5a12 APN 2 110640792 missense probably benign 0.23
R0607:Slc5a12 UTSW 2 110632743 missense probably benign 0.30
R1342:Slc5a12 UTSW 2 110617090 splice site probably null
R1532:Slc5a12 UTSW 2 110610138 missense possibly damaging 0.64
R1992:Slc5a12 UTSW 2 110621744 missense probably benign 0.04
R2354:Slc5a12 UTSW 2 110609432 missense probably damaging 0.97
R3830:Slc5a12 UTSW 2 110632736 nonsense probably null
R4728:Slc5a12 UTSW 2 110644424 nonsense probably null
R4822:Slc5a12 UTSW 2 110621740 missense possibly damaging 0.90
R4937:Slc5a12 UTSW 2 110620408 missense probably damaging 1.00
R5860:Slc5a12 UTSW 2 110597624 missense probably benign 0.30
R6075:Slc5a12 UTSW 2 110616747 missense probably damaging 1.00
R6168:Slc5a12 UTSW 2 110616744 missense probably damaging 1.00
R6853:Slc5a12 UTSW 2 110624194 missense probably benign 0.37
R7014:Slc5a12 UTSW 2 110644364 missense probably benign 0.00
R7135:Slc5a12 UTSW 2 110616714 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAGGTAACAGTGAGTGCCC -3'
(R):5'- TGCACAGTGTACAAGCCTCAAAG -3'

Sequencing Primer
(F):5'- TAACAGTGAGTGCCCCCGAAG -3'
(R):5'- AGTATTACTTAGCACTGAGTCTTCC -3'
Posted On2018-10-18