Incidental Mutation 'R6870:Calm3'
ID536136
Institutional Source Beutler Lab
Gene Symbol Calm3
Ensembl Gene ENSMUSG00000019370
Gene Namecalmodulin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16915379-16924114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16919643 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 9 (Q9L)
Ref Sequence ENSEMBL: ENSMUSP00000019514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019514] [ENSMUST00000172594]
PDB Structure
3-D structure of Myosin-V inhibited state [ELECTRON CRYSTALLOGRAPHY]
Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of Nav1.6 IQ motif in complex with apo-CaM [X-RAY DIFFRACTION]
Calmodulin and Ng peptide complex [X-RAY DIFFRACTION]
Calmodulin and Nm peptide complex [X-RAY DIFFRACTION]
A novel conformation of calmodulin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000019514
AA Change: Q9L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000019514
Gene: ENSMUSG00000019370
AA Change: Q9L

DomainStartEndE-ValueType
EFh 12 40 6.39e-9 SMART
EFh 48 76 5.19e-9 SMART
EFh 85 113 3.67e-9 SMART
EFh 121 149 1.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172594
Predicted Effect probably benign
Transcript: ENSMUST00000173139
SMART Domains Protein: ENSMUSP00000134395
Gene: ENSMUSG00000019370

DomainStartEndE-ValueType
PDB:1YRU|B 2 32 2e-15 PDB
SCOP:d2mysb_ 2 32 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Calm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Calm3 APN 7 16917484 missense probably benign 0.00
R5167:Calm3 UTSW 7 16917701 missense probably damaging 1.00
R5462:Calm3 UTSW 7 16917694 missense possibly damaging 0.93
R6615:Calm3 UTSW 7 16917583 critical splice donor site probably null
R7090:Calm3 UTSW 7 16917079 nonsense probably null
R8429:Calm3 UTSW 7 16919667 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATAGAGGTCCATTTCAAGGCC -3'
(R):5'- TGGCTCTATGACGCGATCTG -3'

Sequencing Primer
(F):5'- TTTCAAGGCCCCAAGTGAGCTATAG -3'
(R):5'- ATGACGCGATCTGCCCTTG -3'
Posted On2018-10-18