Incidental Mutation 'R6870:Map4k1'
ID536137
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Namemitogen-activated protein kinase kinase kinase kinase 1
SynonymsHpk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28982050-29003279 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 29001671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000085835] [ENSMUST00000179893] [ENSMUST00000207185] [ENSMUST00000208227] [ENSMUST00000214374]
Predicted Effect probably benign
Transcript: ENSMUST00000032813
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085835
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179893
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207185
Predicted Effect probably null
Transcript: ENSMUST00000208227
Predicted Effect probably benign
Transcript: ENSMUST00000214374
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 29001619 missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28988607 missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28999872 missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28994106 missense probably benign 0.00
IGL03180:Map4k1 APN 7 28988085 missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28983417 missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28984151 unclassified probably benign
R0333:Map4k1 UTSW 7 28999761 unclassified probably benign
R1296:Map4k1 UTSW 7 28998452 missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28995465 missense probably benign
R1519:Map4k1 UTSW 7 28991036 missense probably benign 0.00
R1711:Map4k1 UTSW 7 28989352 missense possibly damaging 0.80
R1842:Map4k1 UTSW 7 28987163 missense probably damaging 1.00
R1851:Map4k1 UTSW 7 28999784 missense probably benign
R2042:Map4k1 UTSW 7 28984130 missense probably damaging 1.00
R2274:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R2275:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28988595 missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28986654 missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28988770 missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4964:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4966:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R5124:Map4k1 UTSW 7 28988832 missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28994221 missense probably benign 0.37
R5786:Map4k1 UTSW 7 29000020 missense probably damaging 1.00
R6343:Map4k1 UTSW 7 29000290 missense possibly damaging 0.76
R6475:Map4k1 UTSW 7 28987022 missense probably damaging 1.00
R6702:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28986834 missense probably damaging 1.00
R6904:Map4k1 UTSW 7 28986802 missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28991149 missense probably benign
R7572:Map4k1 UTSW 7 28987138 missense probably benign 0.01
R7868:Map4k1 UTSW 7 28999962 critical splice acceptor site probably null
R8034:Map4k1 UTSW 7 28988148 missense probably damaging 1.00
R8054:Map4k1 UTSW 7 28989756 splice site probably benign
R8512:Map4k1 UTSW 7 28996158 missense possibly damaging 0.88
Z1177:Map4k1 UTSW 7 29000008 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTGGTCATAACAGGGTGG -3'
(R):5'- TCACAGAGCTCCCACTCTTGAC -3'

Sequencing Primer
(F):5'- TCATAACAGGGTGGAGCGCAC -3'
(R):5'- ACTCTTGACCCTGGACCC -3'
Posted On2018-10-18