Mutagenetix > Incidental Mutations

Incidental Mutation 'R6870:Nup133'

536144

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6870 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123899507 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1112 (I1112T)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034453] [ENSMUST00000044795] [ENSMUST00000127664] [ENSMUST00000212584]

Predicted Effect

probably benign
Transcript: ENSMUST00000034453

SMART Domains

Protein: ENSMUSP00000034453
Gene: ENSMUSG00000031972

Domain	Start	End	E-Value	Type
ACTIN	7	377	8.06e-237	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000044795
AA Change: I1112T

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: I1112T

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212584

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

72% (39/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,136,408	Y62C	probably benign	Het
A1bg	T	C	15: 60,919,715	T291A	probably damaging	Het
Abcb11	A	G	2: 69,285,298	I574T	possibly damaging	Het
Abcb5	T	A	12: 118,965,265	Y17F	possibly damaging	Het
Arfgef3	A	T	10: 18,646,730	L516*	probably null	Het
Arhgap21	A	G	2: 20,880,510	S619P	probably damaging	Het
Atp2c1	A	G	9: 105,470,062	V65A	probably benign	Het
Calm3	T	A	7: 16,919,643	Q9L	probably benign	Het
Cd300c2	C	T	11: 115,000,677	D124N	probably damaging	Het
Celsr3	A	G	9: 108,829,191	T958A	probably benign	Het
Cfap69	T	C	5: 5,621,958	T317A	probably benign	Het
Cluh	T	A	11: 74,665,384	I887K	probably damaging	Het
Dag1	A	T	9: 108,209,258	V228E	probably damaging	Het
Dhtkd1	T	C	2: 5,919,437		probably null	Het
Dnah1	T	A	14: 31,271,061	K2959*	probably null	Het
Dnttip2	T	A	3: 122,275,808	V224E	probably damaging	Het
Drosha	C	T	15: 12,907,393	P1071L	probably benign	Het
E030025P04Rik	T	A	11: 109,140,167	H84L	unknown	Het
Elac2	A	T	11: 64,999,763	S698C	probably null	Het
Elf2	A	T	3: 51,294,165	*88R	probably null	Het
Fastkd1	T	A	2: 69,708,614	I143L	probably benign	Het
Fbxw10	C	T	11: 62,855,367	R366C	probably damaging	Het
Frg2f1	T	C	4: 119,531,132	M57V	probably benign	Het
Gbp4	T	C	5: 105,125,578	S129G	probably damaging	Het
Gnat2	A	C	3: 108,095,631		probably benign	Het
Golgb1	C	A	16: 36,918,203	F2301L	probably damaging	Het
Il18bp	T	C	7: 102,017,311	T2A	possibly damaging	Het
Kpna2	T	C	11: 106,992,694		probably null	Het
Lrrfip2	A	T	9: 111,216,119		probably benign	Het
Map4k1	T	G	7: 29,001,671		probably null	Het
Mcm3ap	T	C	10: 76,470,215	V54A	probably benign	Het
Olfr906	A	C	9: 38,488,086	D19A	probably benign	Het
Pcdhac1	T	A	18: 37,092,087	V651D	probably damaging	Het
Pde10a	A	G	17: 8,967,524	T571A	possibly damaging	Het
Phc3	A	G	3: 30,936,761	S403P	probably damaging	Het
Prl7b1	T	C	13: 27,604,533	E113G	probably damaging	Het
Psmd2	T	G	16: 20,661,843	M744R	probably benign	Het
Qrich2	T	C	11: 116,455,330	D1556G	probably damaging	Het
Sept1	C	T	7: 127,217,704	V46M	probably benign	Het
Shank2	C	A	7: 144,052,460	Q127K	probably damaging	Het
Siah1a	A	G	8: 86,725,025	V277A	possibly damaging	Het
Slc4a7	T	A	14: 14,733,846	D85E	probably damaging	Het
Slc5a12	A	T	2: 110,641,810	I526F	probably damaging	Het
Svil	T	C	18: 5,063,231	V834A	possibly damaging	Het
Sycp1	T	A	3: 102,935,603	S17C	probably damaging	Het
Tmem2	T	C	19: 21,832,123	S956P	possibly damaging	Het
Tssk6	G	A	8: 69,903,023	R239Q	probably benign	Het
Txnrd1	A	G	10: 82,873,208	D80G	probably benign	Het
Tyk2	A	G	9: 21,124,954	F79S	probably damaging	Het
Tyrp1	T	C	4: 80,850,777	S503P	probably benign	Het
Upf1	A	T	8: 70,341,561	C232S	probably benign	Het
Zeb2	G	A	2: 44,988,910	T1080I	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACTTCAGGTTGATCCAGACC -3'
(R):5'- AATAGGAACCTGCAGGGCTC -3'

Sequencing Primer
(F):5'- GTCACATCTGTCCTTGGA -3'
(R):5'- GGCTCTGAGGCTCTGAAGAG -3'

Posted On

2018-10-18