Mutagenetix > Incidental Mutations

Incidental Mutation 'R6870:Tyk2'

536145

Institutional Source

Beutler Lab

Gene Symbol

Tyk2

Ensembl Gene

ENSMUSG00000032175

Gene Name

tyrosine kinase 2

Synonyms

JTK1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6870 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21104068-21131243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21124954 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 79 (F79S)

Ref Sequence

ENSEMBL: ENSMUSP00000150354 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000214864] [ENSMUST00000216874]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001036
AA Change: F79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: F79S

Domain	Start	End	E-Value	Type
B41	29	301	1.51e-26	SMART
Blast:B41	408	460	3e-12	BLAST
SH2	470	562	1.26e-2	SMART
STYKc	612	886	8.89e-15	SMART
TyrKc	917	1189	6.48e-114	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000214454
AA Change: F79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214864
AA Change: F79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216874
AA Change: F79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9607

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

72% (39/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,136,408	Y62C	probably benign	Het
A1bg	T	C	15: 60,919,715	T291A	probably damaging	Het
Abcb11	A	G	2: 69,285,298	I574T	possibly damaging	Het
Abcb5	T	A	12: 118,965,265	Y17F	possibly damaging	Het
Arfgef3	A	T	10: 18,646,730	L516*	probably null	Het
Arhgap21	A	G	2: 20,880,510	S619P	probably damaging	Het
Atp2c1	A	G	9: 105,470,062	V65A	probably benign	Het
Calm3	T	A	7: 16,919,643	Q9L	probably benign	Het
Cd300c2	C	T	11: 115,000,677	D124N	probably damaging	Het
Celsr3	A	G	9: 108,829,191	T958A	probably benign	Het
Cfap69	T	C	5: 5,621,958	T317A	probably benign	Het
Cluh	T	A	11: 74,665,384	I887K	probably damaging	Het
Dag1	A	T	9: 108,209,258	V228E	probably damaging	Het
Dhtkd1	T	C	2: 5,919,437		probably null	Het
Dnah1	T	A	14: 31,271,061	K2959*	probably null	Het
Dnttip2	T	A	3: 122,275,808	V224E	probably damaging	Het
Drosha	C	T	15: 12,907,393	P1071L	probably benign	Het
E030025P04Rik	T	A	11: 109,140,167	H84L	unknown	Het
Elac2	A	T	11: 64,999,763	S698C	probably null	Het
Elf2	A	T	3: 51,294,165	*88R	probably null	Het
Fastkd1	T	A	2: 69,708,614	I143L	probably benign	Het
Fbxw10	C	T	11: 62,855,367	R366C	probably damaging	Het
Frg2f1	T	C	4: 119,531,132	M57V	probably benign	Het
Gbp4	T	C	5: 105,125,578	S129G	probably damaging	Het
Gnat2	A	C	3: 108,095,631		probably benign	Het
Golgb1	C	A	16: 36,918,203	F2301L	probably damaging	Het
Il18bp	T	C	7: 102,017,311	T2A	possibly damaging	Het
Kpna2	T	C	11: 106,992,694		probably null	Het
Lrrfip2	A	T	9: 111,216,119		probably benign	Het
Map4k1	T	G	7: 29,001,671		probably null	Het
Mcm3ap	T	C	10: 76,470,215	V54A	probably benign	Het
Nup133	A	G	8: 123,899,507	I1112T	probably benign	Het
Olfr906	A	C	9: 38,488,086	D19A	probably benign	Het
Pcdhac1	T	A	18: 37,092,087	V651D	probably damaging	Het
Pde10a	A	G	17: 8,967,524	T571A	possibly damaging	Het
Phc3	A	G	3: 30,936,761	S403P	probably damaging	Het
Prl7b1	T	C	13: 27,604,533	E113G	probably damaging	Het
Psmd2	T	G	16: 20,661,843	M744R	probably benign	Het
Qrich2	T	C	11: 116,455,330	D1556G	probably damaging	Het
Sept1	C	T	7: 127,217,704	V46M	probably benign	Het
Shank2	C	A	7: 144,052,460	Q127K	probably damaging	Het
Siah1a	A	G	8: 86,725,025	V277A	possibly damaging	Het
Slc4a7	T	A	14: 14,733,846	D85E	probably damaging	Het
Slc5a12	A	T	2: 110,641,810	I526F	probably damaging	Het
Svil	T	C	18: 5,063,231	V834A	possibly damaging	Het
Sycp1	T	A	3: 102,935,603	S17C	probably damaging	Het
Tmem2	T	C	19: 21,832,123	S956P	possibly damaging	Het
Tssk6	G	A	8: 69,903,023	R239Q	probably benign	Het
Txnrd1	A	G	10: 82,873,208	D80G	probably benign	Het
Tyrp1	T	C	4: 80,850,777	S503P	probably benign	Het
Upf1	A	T	8: 70,341,561	C232S	probably benign	Het
Zeb2	G	A	2: 44,988,910	T1080I	probably damaging	Het

Other mutations in Tyk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Tyk2	APN	9	21120588	missense	probably benign	0.27
IGL01015:Tyk2	APN	9	21120700	missense	probably benign	0.00
IGL01096:Tyk2	APN	9	21108863	missense	probably damaging	1.00
IGL01410:Tyk2	APN	9	21109364	missense	probably damaging	1.00
IGL01613:Tyk2	APN	9	21120576	missense	probably damaging	0.99
IGL01997:Tyk2	APN	9	21110494	missense	probably damaging	1.00
IGL02249:Tyk2	APN	9	21120407	missense	probably damaging	1.00
IGL02407:Tyk2	APN	9	21109227	splice site	probably benign
IGL02538:Tyk2	APN	9	21111043	missense	possibly damaging	0.94
IGL03185:Tyk2	APN	9	21109384	missense	probably damaging	1.00
ANU74:Tyk2	UTSW	9	21116158	missense	probably damaging	1.00
R0355:Tyk2	UTSW	9	21114190	splice site	probably null
R0667:Tyk2	UTSW	9	21108871	missense	probably damaging	1.00
R0862:Tyk2	UTSW	9	21116167	missense	probably benign	0.00
R0883:Tyk2	UTSW	9	21111137	missense	possibly damaging	0.61
R1554:Tyk2	UTSW	9	21107922	missense	probably damaging	0.96
R1575:Tyk2	UTSW	9	21115462	missense	probably benign	0.00
R1664:Tyk2	UTSW	9	21120353	missense	probably damaging	1.00
R1676:Tyk2	UTSW	9	21115249	nonsense	probably null
R1843:Tyk2	UTSW	9	21121554	nonsense	probably null
R1871:Tyk2	UTSW	9	21121441	missense	probably damaging	1.00
R2044:Tyk2	UTSW	9	21120341	missense	probably damaging	1.00
R2137:Tyk2	UTSW	9	21110985	intron	probably benign
R2197:Tyk2	UTSW	9	21115207	missense	probably damaging	1.00
R2883:Tyk2	UTSW	9	21110587	missense	probably benign	0.01
R2941:Tyk2	UTSW	9	21111119	missense	probably benign	0.00
R3001:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3002:Tyk2	UTSW	9	21109321	missense	probably benign	0.00
R3196:Tyk2	UTSW	9	21124032	missense	possibly damaging	0.80
R3622:Tyk2	UTSW	9	21127310	missense	probably damaging	0.98
R4024:Tyk2	UTSW	9	21115919	missense	probably damaging	1.00
R4459:Tyk2	UTSW	9	21124415	missense	probably damaging	1.00
R4604:Tyk2	UTSW	9	21108009	missense	probably damaging	1.00
R4664:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4666:Tyk2	UTSW	9	21114207	missense	probably damaging	0.99
R4915:Tyk2	UTSW	9	21111137	missense	probably benign	0.41
R4971:Tyk2	UTSW	9	21120501	critical splice donor site	probably null
R5014:Tyk2	UTSW	9	21115830	splice site	probably null
R5191:Tyk2	UTSW	9	21107497	missense	probably damaging	0.98
R5305:Tyk2	UTSW	9	21109381	missense	probably damaging	0.99
R5356:Tyk2	UTSW	9	21115744	missense	probably benign	0.03
R5501:Tyk2	UTSW	9	21121612	missense	probably damaging	1.00
R6025:Tyk2	UTSW	9	21115960	missense	probably benign	0.05
R6113:Tyk2	UTSW	9	21107922	missense	probably damaging	1.00
R6159:Tyk2	UTSW	9	21110504	missense	probably damaging	0.99
R6608:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6610:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R6612:Tyk2	UTSW	9	21108016	missense	probably benign	0.02
R7216:Tyk2	UTSW	9	21120526	missense	probably benign	0.01
R7218:Tyk2	UTSW	9	21105054	missense	probably damaging	1.00
R7298:Tyk2	UTSW	9	21108860	missense	probably benign	0.35
R7322:Tyk2	UTSW	9	21110204	missense	probably benign
R7347:Tyk2	UTSW	9	21108034	missense	probably damaging	0.99
R7759:Tyk2	UTSW	9	21120258	critical splice donor site	probably null
R7840:Tyk2	UTSW	9	21124967	missense	probably damaging	1.00
R7854:Tyk2	UTSW	9	21115480	missense	probably benign
R7914:Tyk2	UTSW	9	21121555	missense	probably benign	0.01
R8312:Tyk2	UTSW	9	21115649	missense	possibly damaging	0.69
Z1177:Tyk2	UTSW	9	21105367	missense	probably benign
Z1177:Tyk2	UTSW	9	21108875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGATACATGGGTGTGCACG -3'
(R):5'- ACATAGTCCAGTGTCCCTACC -3'

Sequencing Primer
(F):5'- TGCGCGCATGCACACAC -3'
(R):5'- CCAACCTGCAAGGAAGCTG -3'

Posted On

2018-10-18