Incidental Mutation 'R6870:Olfr906'
ID536146
Institutional Source Beutler Lab
Gene Symbol Olfr906
Ensembl Gene ENSMUSG00000039962
Gene Nameolfactory receptor 906
SynonymsMOR167-2, GA_x6K02T2PVTD-32194085-32195020
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38487085-38491560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38488086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 19 (D19A)
Ref Sequence ENSEMBL: ENSMUSP00000151008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045493] [ENSMUST00000214344]
Predicted Effect probably benign
Transcript: ENSMUST00000045493
AA Change: D19A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039040
Gene: ENSMUSG00000039962
AA Change: D19A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-50 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214344
AA Change: D19A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Olfr906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03127:Olfr906 APN 9 38488586 missense probably benign 0.13
R0948:Olfr906 UTSW 9 38488948 missense probably benign 0.00
R1236:Olfr906 UTSW 9 38488229 missense probably damaging 1.00
R1246:Olfr906 UTSW 9 38488790 missense probably damaging 1.00
R1442:Olfr906 UTSW 9 38488643 missense probably benign 0.10
R2016:Olfr906 UTSW 9 38488013 critical splice acceptor site probably null
R2264:Olfr906 UTSW 9 38488055 missense possibly damaging 0.50
R2268:Olfr906 UTSW 9 38488208 missense probably damaging 1.00
R3853:Olfr906 UTSW 9 38488951 missense probably benign 0.18
R4066:Olfr906 UTSW 9 38488482 missense probably benign 0.17
R4594:Olfr906 UTSW 9 38488761 missense probably damaging 0.98
R5192:Olfr906 UTSW 9 38488805 missense possibly damaging 0.69
R5436:Olfr906 UTSW 9 38488539 missense probably benign 0.31
R5598:Olfr906 UTSW 9 38488525 missense possibly damaging 0.77
R5694:Olfr906 UTSW 9 38488236 missense probably damaging 1.00
R5914:Olfr906 UTSW 9 38488361 missense probably damaging 1.00
R5959:Olfr906 UTSW 9 38488911 missense probably damaging 1.00
R6318:Olfr906 UTSW 9 38488377 missense probably benign
R7482:Olfr906 UTSW 9 38488451 missense probably damaging 0.99
R7571:Olfr906 UTSW 9 38488656 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACTCATGGTCATGATAATGGC -3'
(R):5'- CATTTTGGGTGTAAACACTGAAGAG -3'

Sequencing Primer
(F):5'- CTCATGGTCATGATAATGGCAAATTC -3'
(R):5'- CACTGAAGAGTAACAGAGGTCTATC -3'
Posted On2018-10-18