Incidental Mutation 'R6870:Txnrd1'
ID536152
Institutional Source Beutler Lab
Gene Symbol Txnrd1
Ensembl Gene ENSMUSG00000020250
Gene Namethioredoxin reductase 1
SynonymsTR1, TR, TrxR1, TR alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6870 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location82833951-82897712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82873208 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000151629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020484] [ENSMUST00000218694] [ENSMUST00000219368] [ENSMUST00000219442] [ENSMUST00000219962]
Predicted Effect probably benign
Transcript: ENSMUST00000020484
SMART Domains Protein: ENSMUSP00000020484
Gene: ENSMUSG00000020250

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 13 350 9.7e-69 PFAM
Pfam:FAD_binding_2 14 69 2.6e-8 PFAM
Pfam:Pyr_redox 192 273 1.3e-18 PFAM
Pfam:Pyr_redox_dim 370 483 8.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218694
Predicted Effect probably benign
Transcript: ENSMUST00000219368
AA Change: D80G

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219442
Predicted Effect probably benign
Transcript: ENSMUST00000219962
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide-disulfide oxidoreductases. This protein is a flavoenzyme, which uses NADPH for reduction of thioredoxins as well as other protein and nonprotein substrates, and plays a role in protection against oxidative stress. It contains a selenocysteine (Sec) residue, which is essential for catalytic activity. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit early embryonic lethality (by E10.5) and display severe growth retardation and fail to turn. Embryos also exhibit decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Txnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txnrd1 APN 10 82875662 missense probably damaging 1.00
IGL00644:Txnrd1 APN 10 82885176 splice site probably benign
IGL01995:Txnrd1 APN 10 82877284 missense probably damaging 1.00
IGL02167:Txnrd1 APN 10 82881911 missense probably benign 0.01
IGL02368:Txnrd1 APN 10 82895974 splice site probably null
IGL02500:Txnrd1 APN 10 82879217 missense probably damaging 1.00
IGL02870:Txnrd1 APN 10 82895979 missense probably benign 0.13
IGL03188:Txnrd1 APN 10 82885046 missense possibly damaging 0.79
IGL03257:Txnrd1 APN 10 82885271 missense probably benign 0.00
F6893:Txnrd1 UTSW 10 82866989 nonsense probably null
R0092:Txnrd1 UTSW 10 82879802 missense probably damaging 1.00
R2019:Txnrd1 UTSW 10 82877373 missense probably benign 0.00
R2088:Txnrd1 UTSW 10 82883910 splice site probably benign
R2101:Txnrd1 UTSW 10 82881739 missense probably damaging 1.00
R2120:Txnrd1 UTSW 10 82887233 missense possibly damaging 0.86
R2696:Txnrd1 UTSW 10 82885282 missense probably benign 0.05
R4058:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4059:Txnrd1 UTSW 10 82885280 missense probably benign 0.03
R4879:Txnrd1 UTSW 10 82881917 unclassified probably null
R5582:Txnrd1 UTSW 10 82895980 missense possibly damaging 0.72
R6965:Txnrd1 UTSW 10 82881818 missense probably benign 0.02
R7336:Txnrd1 UTSW 10 82873217 missense probably benign 0.00
R7449:Txnrd1 UTSW 10 82885233 nonsense probably null
RF019:Txnrd1 UTSW 10 82885100 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATGACTGCTGGCTGTACTTC -3'
(R):5'- CCCTGGGCTAATGAGGGTAATG -3'

Sequencing Primer
(F):5'- AGAACCTTTGTGCAGACTGTC -3'
(R):5'- TAATGACAGAAAAGTTAGCAAGCAC -3'
Posted On2018-10-18