Incidental Mutation 'R6870:Elac2'
ID536154
Institutional Source Beutler Lab
Gene Symbol Elac2
Ensembl Gene ENSMUSG00000020549
Gene NameelaC ribonuclease Z 2
Synonyms1110017O07Rik, tRNase Z(L), D11Wsu80e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6870 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location64979038-65002069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64999763 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 698 (S698C)
Ref Sequence ENSEMBL: ENSMUSP00000104337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000071891] [ENSMUST00000093002] [ENSMUST00000101049] [ENSMUST00000108697]
Predicted Effect probably benign
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071891
AA Change: S699C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071788
Gene: ENSMUSG00000020549
AA Change: S699C

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 1.5e-16 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101049
AA Change: S699C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098610
Gene: ENSMUSG00000020549
AA Change: S699C

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 3.1e-17 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108697
AA Change: S698C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104337
Gene: ENSMUSG00000020549
AA Change: S698C

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 9.8e-19 PFAM
Lactamase_B 493 697 1.75e0 SMART
low complexity region 771 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a C-terminal domain with tRNA 3′ processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Elac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Elac2 APN 11 64980650 missense possibly damaging 0.92
IGL02035:Elac2 APN 11 65001835 missense probably benign
IGL02407:Elac2 APN 11 64999175 missense probably benign 0.01
R0329:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0360:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0364:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0526:Elac2 UTSW 11 64999436 missense probably benign 0.07
R0729:Elac2 UTSW 11 64998523 missense possibly damaging 0.62
R1912:Elac2 UTSW 11 64994263 missense probably benign
R1929:Elac2 UTSW 11 64979189 missense probably benign 0.00
R2345:Elac2 UTSW 11 65001074 missense probably damaging 0.99
R4765:Elac2 UTSW 11 64992222 missense probably damaging 1.00
R4828:Elac2 UTSW 11 64995327 missense probably damaging 1.00
R5000:Elac2 UTSW 11 64985553 missense probably benign
R5109:Elac2 UTSW 11 64992316 missense probably damaging 1.00
R5391:Elac2 UTSW 11 64994294 missense probably benign
R5865:Elac2 UTSW 11 64997957 missense probably benign 0.39
R5953:Elac2 UTSW 11 64999223 missense probably benign 0.00
R6800:Elac2 UTSW 11 64999439 critical splice donor site probably null
R6829:Elac2 UTSW 11 64989364 missense probably benign
R7037:Elac2 UTSW 11 64983711 missense probably benign
R7869:Elac2 UTSW 11 64999387 missense probably damaging 0.99
R8087:Elac2 UTSW 11 64979208 missense probably benign 0.14
R8139:Elac2 UTSW 11 64980614 missense probably benign 0.28
X0020:Elac2 UTSW 11 64987458 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTGAGGACACATCACAGGAC -3'
(R):5'- CCTAGCTGGGGATTTGCAAAC -3'

Sequencing Primer
(F):5'- CCGAGAGAGCTGAGTATTTGG -3'
(R):5'- TTTGCAAACACAGAGGCCTTGTG -3'
Posted On2018-10-18