Incidental Mutation 'R6870:Kpna2'
ID536156
Institutional Source Beutler Lab
Gene Symbol Kpna2
Ensembl Gene ENSMUSG00000018362
Gene Namekaryopherin (importin) alpha 2
Synonyms2410044B12Rik, pendulin, m-importin-alpha-P1, m-importin, Rch1, Importin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6870 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106988629-106999541 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 106992694 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018506] [ENSMUST00000106768] [ENSMUST00000124541] [ENSMUST00000140362] [ENSMUST00000144834] [ENSMUST00000145331]
Predicted Effect probably null
Transcript: ENSMUST00000018506
SMART Domains Protein: ENSMUSP00000018506
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106768
SMART Domains Protein: ENSMUSP00000102379
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 79 4.9e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124541
SMART Domains Protein: ENSMUSP00000114636
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.7e-29 PFAM
Pfam:Arm 108 149 4.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140362
SMART Domains Protein: ENSMUSP00000118679
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 24 118 9.7e-30 PFAM
Pfam:Arm 127 168 1.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144834
SMART Domains Protein: ENSMUSP00000121655
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 99 5.1e-29 PFAM
Pfam:Arm 108 149 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145331
SMART Domains Protein: ENSMUSP00000122983
Gene: ENSMUSG00000018362

DomainStartEndE-ValueType
Pfam:IBB 5 74 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The import of proteins into the nucleus is a process that involves at least 2 steps. The first is an energy-independent docking of the protein to the nuclear envelope and the second is an energy-dependent translocation through the nuclear pore complex. Imported proteins require a nuclear localization sequence (NLS) which generally consists of a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart. Proteins involved in the first step of nuclear import have been identified in different systems. These include the Xenopus protein importin and its yeast homolog, SRP1 (a suppressor of certain temperature-sensitive mutations of RNA polymerase I in Saccharomyces cerevisiae), which bind to the NLS. KPNA2 protein interacts with the NLSs of DNA helicase Q1 and SV40 T antigen and may be involved in the nuclear transport of proteins. KPNA2 also may play a role in V(D)J recombination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Kpna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Kpna2 APN 11 106991201 missense probably benign 0.01
IGL02985:Kpna2 APN 11 106989337 missense probably benign 0.11
R0016:Kpna2 UTSW 11 106991086 missense probably benign
R0233:Kpna2 UTSW 11 106992631 missense probably benign 0.03
R0359:Kpna2 UTSW 11 106991322 missense probably damaging 1.00
R1450:Kpna2 UTSW 11 106997309 missense probably benign 0.05
R1750:Kpna2 UTSW 11 106991445 missense probably damaging 0.99
R4751:Kpna2 UTSW 11 106992664 missense possibly damaging 0.85
R4762:Kpna2 UTSW 11 106990259 missense probably benign 0.04
R4911:Kpna2 UTSW 11 106990719 missense probably damaging 1.00
R4952:Kpna2 UTSW 11 106991235 missense probably damaging 1.00
R4976:Kpna2 UTSW 11 106991469 missense probably damaging 1.00
R5283:Kpna2 UTSW 11 106990832 missense probably damaging 1.00
R5564:Kpna2 UTSW 11 106990745 missense probably damaging 1.00
R7599:Kpna2 UTSW 11 106998757 missense probably null
R7606:Kpna2 UTSW 11 106992058 missense probably damaging 0.99
R7672:Kpna2 UTSW 11 106988963 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATTCATGATTCTCCACTGCA -3'
(R):5'- ATGCCATGTGTGCTAGTGT -3'

Sequencing Primer
(F):5'- ATGATTCTCCACTGCACCTCC -3'
(R):5'- ATGGTGCTGCCCACATTAAG -3'
Posted On2018-10-18