Incidental Mutation 'R6870:Qrich2'
ID536159
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116455330 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1556 (D1556G)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208602
AA Change: D1556G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6211:Qrich2 UTSW 11 116453542 missense probably benign 0.41
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7923:Qrich2 UTSW 11 116457337 missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116457035 small deletion probably benign
R8225:Qrich2 UTSW 11 116454068 missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116456349 missense probably benign 0.04
R8391:Qrich2 UTSW 11 116465577 missense probably benign 0.00
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCTTGGAGGCAGTGACTC -3'
(R):5'- AGACTTTGTAACACCAAGCATAGAC -3'

Sequencing Primer
(F):5'- AGTGACTCCTGCCGCTG -3'
(R):5'- TTTGTAACACCAAGCATAGACCTTCG -3'
Posted On2018-10-18