Mutagenetix > Incidental Mutations

Incidental Mutation 'R6870:Drosha'

536164

Institutional Source

Beutler Lab

Gene Symbol

Drosha

Ensembl Gene

ENSMUSG00000022191

Gene Name

drosha, ribonuclease type III

Synonyms

1110013A17Rik, Rnasen, Etohi2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R6870 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12824815-12935291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12907393 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1071 (P1071L)

Ref Sequence

ENSEMBL: ENSMUSP00000129279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]

Predicted Effect

probably benign
Transcript: ENSMUST00000090292
AA Change: P1071L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: P1071L

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169061
AA Change: P1071L

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: P1071L

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

72% (39/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,136,408	Y62C	probably benign	Het
A1bg	T	C	15: 60,919,715	T291A	probably damaging	Het
Abcb11	A	G	2: 69,285,298	I574T	possibly damaging	Het
Abcb5	T	A	12: 118,965,265	Y17F	possibly damaging	Het
Arfgef3	A	T	10: 18,646,730	L516*	probably null	Het
Arhgap21	A	G	2: 20,880,510	S619P	probably damaging	Het
Atp2c1	A	G	9: 105,470,062	V65A	probably benign	Het
Calm3	T	A	7: 16,919,643	Q9L	probably benign	Het
Cd300c2	C	T	11: 115,000,677	D124N	probably damaging	Het
Celsr3	A	G	9: 108,829,191	T958A	probably benign	Het
Cfap69	T	C	5: 5,621,958	T317A	probably benign	Het
Cluh	T	A	11: 74,665,384	I887K	probably damaging	Het
Dag1	A	T	9: 108,209,258	V228E	probably damaging	Het
Dhtkd1	T	C	2: 5,919,437		probably null	Het
Dnah1	T	A	14: 31,271,061	K2959*	probably null	Het
Dnttip2	T	A	3: 122,275,808	V224E	probably damaging	Het
E030025P04Rik	T	A	11: 109,140,167	H84L	unknown	Het
Elac2	A	T	11: 64,999,763	S698C	probably null	Het
Elf2	A	T	3: 51,294,165	*88R	probably null	Het
Fastkd1	T	A	2: 69,708,614	I143L	probably benign	Het
Fbxw10	C	T	11: 62,855,367	R366C	probably damaging	Het
Frg2f1	T	C	4: 119,531,132	M57V	probably benign	Het
Gbp4	T	C	5: 105,125,578	S129G	probably damaging	Het
Gnat2	A	C	3: 108,095,631		probably benign	Het
Golgb1	C	A	16: 36,918,203	F2301L	probably damaging	Het
Il18bp	T	C	7: 102,017,311	T2A	possibly damaging	Het
Kpna2	T	C	11: 106,992,694		probably null	Het
Lrrfip2	A	T	9: 111,216,119		probably benign	Het
Map4k1	T	G	7: 29,001,671		probably null	Het
Mcm3ap	T	C	10: 76,470,215	V54A	probably benign	Het
Nup133	A	G	8: 123,899,507	I1112T	probably benign	Het
Olfr906	A	C	9: 38,488,086	D19A	probably benign	Het
Pcdhac1	T	A	18: 37,092,087	V651D	probably damaging	Het
Pde10a	A	G	17: 8,967,524	T571A	possibly damaging	Het
Phc3	A	G	3: 30,936,761	S403P	probably damaging	Het
Prl7b1	T	C	13: 27,604,533	E113G	probably damaging	Het
Psmd2	T	G	16: 20,661,843	M744R	probably benign	Het
Qrich2	T	C	11: 116,455,330	D1556G	probably damaging	Het
Sept1	C	T	7: 127,217,704	V46M	probably benign	Het
Shank2	C	A	7: 144,052,460	Q127K	probably damaging	Het
Siah1a	A	G	8: 86,725,025	V277A	possibly damaging	Het
Slc4a7	T	A	14: 14,733,846	D85E	probably damaging	Het
Slc5a12	A	T	2: 110,641,810	I526F	probably damaging	Het
Svil	T	C	18: 5,063,231	V834A	possibly damaging	Het
Sycp1	T	A	3: 102,935,603	S17C	probably damaging	Het
Tmem2	T	C	19: 21,832,123	S956P	possibly damaging	Het
Tssk6	G	A	8: 69,903,023	R239Q	probably benign	Het
Txnrd1	A	G	10: 82,873,208	D80G	probably benign	Het
Tyk2	A	G	9: 21,124,954	F79S	probably damaging	Het
Tyrp1	T	C	4: 80,850,777	S503P	probably benign	Het
Upf1	A	T	8: 70,341,561	C232S	probably benign	Het
Zeb2	G	A	2: 44,988,910	T1080I	probably damaging	Het

Other mutations in Drosha

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Drosha	APN	15	12883194	missense	probably damaging	0.99
IGL00736:Drosha	APN	15	12833959	missense	unknown
IGL00963:Drosha	APN	15	12925997	missense	probably damaging	0.99
IGL01010:Drosha	APN	15	12827289	unclassified	probably benign
IGL01340:Drosha	APN	15	12834023	intron	probably benign
IGL01481:Drosha	APN	15	12842439	missense	probably benign
IGL01714:Drosha	APN	15	12878784	missense	probably damaging	1.00
IGL01721:Drosha	APN	15	12846112	nonsense	probably null
IGL01765:Drosha	APN	15	12902680	missense	probably damaging	1.00
IGL01893:Drosha	APN	15	12866650	splice site	probably benign
IGL01944:Drosha	APN	15	12889719	missense	probably damaging	1.00
IGL02285:Drosha	APN	15	12833864	missense	unknown
IGL02970:Drosha	APN	15	12913956	missense	probably damaging	0.98
IGL02990:Drosha	APN	15	12827267	unclassified	probably benign
IGL03019:Drosha	APN	15	12846099	missense	probably damaging	1.00
IGL03279:Drosha	APN	15	12859392	missense	probably benign	0.03
IGL03390:Drosha	APN	15	12884983	splice site	probably null
tippicanoe	UTSW	15	12859465	splice site	probably null
Tyler	UTSW	15	12861706	missense	probably benign	0.45
R0115:Drosha	UTSW	15	12846130	missense	probably benign	0.15
R0352:Drosha	UTSW	15	12837288	missense	unknown
R0401:Drosha	UTSW	15	12926031	nonsense	probably null
R0541:Drosha	UTSW	15	12907388	missense	probably benign	0.09
R0784:Drosha	UTSW	15	12867678	splice site	probably benign
R0918:Drosha	UTSW	15	12842533	critical splice donor site	probably null
R1473:Drosha	UTSW	15	12912520	missense	probably benign	0.04
R1503:Drosha	UTSW	15	12848073	missense	probably benign	0.02
R1526:Drosha	UTSW	15	12913984	missense	probably damaging	1.00
R1809:Drosha	UTSW	15	12890112	missense	probably null	1.00
R1859:Drosha	UTSW	15	12878718	missense	probably benign	0.14
R2004:Drosha	UTSW	15	12915381	missense	probably damaging	0.98
R2060:Drosha	UTSW	15	12924159	missense	possibly damaging	0.94
R2516:Drosha	UTSW	15	12859465	splice site	probably null
R3691:Drosha	UTSW	15	12834638	missense	unknown
R3784:Drosha	UTSW	15	12890529	missense	possibly damaging	0.82
R3789:Drosha	UTSW	15	12912537	nonsense	probably null
R3790:Drosha	UTSW	15	12912537	nonsense	probably null
R4020:Drosha	UTSW	15	12837336	missense	possibly damaging	0.96
R4817:Drosha	UTSW	15	12914047	missense	probably damaging	0.97
R4989:Drosha	UTSW	15	12935007	missense	probably benign	0.05
R5080:Drosha	UTSW	15	12842143	missense	probably benign	0.01
R5132:Drosha	UTSW	15	12837291	missense	unknown
R5215:Drosha	UTSW	15	12885133	intron	probably benign
R5386:Drosha	UTSW	15	12842121	missense	probably benign
R5457:Drosha	UTSW	15	12926029	missense	probably benign	0.26
R5536:Drosha	UTSW	15	12929711	missense	possibly damaging	0.58
R5800:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R5800:Drosha	UTSW	15	12902647	missense	probably damaging	1.00
R5915:Drosha	UTSW	15	12935066	missense	probably damaging	0.97
R5988:Drosha	UTSW	15	12834496	intron	probably benign
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6063:Drosha	UTSW	15	12834070	intron	probably benign
R6391:Drosha	UTSW	15	12889717	nonsense	probably null
R6492:Drosha	UTSW	15	12861706	missense	probably benign	0.45
R6799:Drosha	UTSW	15	12912537	nonsense	probably null
R6920:Drosha	UTSW	15	12834310	missense	unknown
R7101:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R7142:Drosha	UTSW	15	12924146	missense	possibly damaging	0.70
R7275:Drosha	UTSW	15	12846083	missense	possibly damaging	0.73
R7337:Drosha	UTSW	15	12846199	missense	possibly damaging	0.80
R7471:Drosha	UTSW	15	12889656	missense	probably damaging	1.00
R7538:Drosha	UTSW	15	12926243	missense	probably damaging	1.00
R7559:Drosha	UTSW	15	12842422	missense	probably damaging	0.96
R7651:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7652:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7653:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7727:Drosha	UTSW	15	12881645	missense	probably damaging	1.00
R7780:Drosha	UTSW	15	12848086	missense	probably benign	0.01
R8068:Drosha	UTSW	15	12883190	nonsense	probably null
Z1177:Drosha	UTSW	15	12842092	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCTTTAAAACAGTCTGCGC -3'
(R):5'- CTGCAGAACATAACAACTCCTATTG -3'

Sequencing Primer
(F):5'- CTAGGCTCTCTGCTGTGACTG -3'
(R):5'- GGAGGCTGGCACTTAGT -3'

Posted On

2018-10-18