Incidental Mutation 'R6870:1700088E04Rik'
ID536166
Institutional Source Beutler Lab
Gene Symbol 1700088E04Rik
Ensembl Gene ENSMUSG00000033029
Gene NameRIKEN cDNA 1700088E04 gene
SynonymsMus EST J0827E04
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location79129349-79141253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79136408 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000140611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040077] [ENSMUST00000040320] [ENSMUST00000169604] [ENSMUST00000186053] [ENSMUST00000186459] [ENSMUST00000187550] [ENSMUST00000188562] [ENSMUST00000189761] [ENSMUST00000190509] [ENSMUST00000190730] [ENSMUST00000190959] [ENSMUST00000229031] [ENSMUST00000229973] [ENSMUST00000230271]
Predicted Effect probably benign
Transcript: ENSMUST00000040077
SMART Domains Protein: ENSMUSP00000043566
Gene: ENSMUSG00000033020

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
Pfam:RNA_pol_Rpb6 51 104 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040320
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169604
AA Change: Y83C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029
AA Change: Y83C

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186053
SMART Domains Protein: ENSMUSP00000140261
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 58 3.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186459
SMART Domains Protein: ENSMUSP00000139974
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 54 5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187550
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188562
Predicted Effect probably benign
Transcript: ENSMUST00000189761
SMART Domains Protein: ENSMUSP00000139736
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 39 4.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190400
Predicted Effect probably benign
Transcript: ENSMUST00000190509
AA Change: Y62C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140611
Gene: ENSMUSG00000033029
AA Change: Y62C

DomainStartEndE-ValueType
Pfam:UPF0193 33 195 4.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190730
SMART Domains Protein: ENSMUSP00000139884
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190959
AA Change: Y83C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029
AA Change: Y83C

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191006
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Predicted Effect probably benign
Transcript: ENSMUST00000229973
Predicted Effect probably benign
Transcript: ENSMUST00000230271
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Psmd2 T G 16: 20,661,843 M744R probably benign Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in 1700088E04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:1700088E04Rik APN 15 79139253 missense possibly damaging 0.88
R1127:1700088E04Rik UTSW 15 79135203 missense probably benign 0.36
R2184:1700088E04Rik UTSW 15 79135189 missense probably damaging 1.00
R4832:1700088E04Rik UTSW 15 79135209 missense probably damaging 1.00
R7798:1700088E04Rik UTSW 15 79135732 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTTGCTTGAATGATGCTGTCC -3'
(R):5'- TGTAAGAACCGAGTGTGCG -3'

Sequencing Primer
(F):5'- CTTGAATGATGCTGTCCCAGGC -3'
(R):5'- CACCCTTGGATATGTTCTAGAAGC -3'
Posted On2018-10-18