Mutagenetix > Incidental Mutation

Incidental Mutation 'R6870:Psmd2'

536167

Institutional Source

Beutler Lab

Gene Symbol

Psmd2

Ensembl Gene

ENSMUSG00000006998

Gene Name

proteasome (prosome, macropain) 26S subunit, non-ATPase, 2

Synonyms

TEG-190, Tex190, 9430095H01Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R6870 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20651652-20663414 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20661843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 744 (M744R)

Ref Sequence

ENSEMBL: ENSMUSP00000007212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207]

AlphaFold

Q8VDM4

Predicted Effect

probably benign
Transcript: ENSMUST00000007212
AA Change: M744R

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: M744R

Domain	Start	End	E-Value	Type
Pfam:PC_rep	443	479	3.7e-9	PFAM
Pfam:PC_rep	480	514	1.3e-8	PFAM
low complexity region	571	581	N/A	INTRINSIC
SCOP:d1gw5b_	617	773	1e-8	SMART
PDB:4CR4\|Z	653	906	3e-57	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172207

Predicted Effect

probably benign
Transcript: ENSMUST00000231897

Predicted Effect

probably benign
Transcript: ENSMUST00000232513

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

72% (39/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,136,408	Y62C	probably benign	Het
A1bg	T	C	15: 60,919,715	T291A	probably damaging	Het
Abcb11	A	G	2: 69,285,298	I574T	possibly damaging	Het
Abcb5	T	A	12: 118,965,265	Y17F	possibly damaging	Het
Arfgef3	A	T	10: 18,646,730	L516*	probably null	Het
Arhgap21	A	G	2: 20,880,510	S619P	probably damaging	Het
Atp2c1	A	G	9: 105,470,062	V65A	probably benign	Het
Calm3	T	A	7: 16,919,643	Q9L	probably benign	Het
Cd300c2	C	T	11: 115,000,677	D124N	probably damaging	Het
Celsr3	A	G	9: 108,829,191	T958A	probably benign	Het
Cfap69	T	C	5: 5,621,958	T317A	probably benign	Het
Cluh	T	A	11: 74,665,384	I887K	probably damaging	Het
Dag1	A	T	9: 108,209,258	V228E	probably damaging	Het
Dhtkd1	T	C	2: 5,919,437		probably null	Het
Dnah1	T	A	14: 31,271,061	K2959*	probably null	Het
Dnttip2	T	A	3: 122,275,808	V224E	probably damaging	Het
Drosha	C	T	15: 12,907,393	P1071L	probably benign	Het
E030025P04Rik	T	A	11: 109,140,167	H84L	unknown	Het
Elac2	A	T	11: 64,999,763	S698C	probably null	Het
Elf2	A	T	3: 51,294,165	*88R	probably null	Het
Fastkd1	T	A	2: 69,708,614	I143L	probably benign	Het
Fbxw10	C	T	11: 62,855,367	R366C	probably damaging	Het
Frg2f1	T	C	4: 119,531,132	M57V	probably benign	Het
Gbp4	T	C	5: 105,125,578	S129G	probably damaging	Het
Gnat2	A	C	3: 108,095,631		probably benign	Het
Golgb1	C	A	16: 36,918,203	F2301L	probably damaging	Het
Il18bp	T	C	7: 102,017,311	T2A	possibly damaging	Het
Kpna2	T	C	11: 106,992,694		probably null	Het
Lrrfip2	A	T	9: 111,216,119		probably benign	Het
Map4k1	T	G	7: 29,001,671		probably null	Het
Mcm3ap	T	C	10: 76,470,215	V54A	probably benign	Het
Nup133	A	G	8: 123,899,507	I1112T	probably benign	Het
Olfr906	A	C	9: 38,488,086	D19A	probably benign	Het
Pcdhac1	T	A	18: 37,092,087	V651D	probably damaging	Het
Pde10a	A	G	17: 8,967,524	T571A	possibly damaging	Het
Phc3	A	G	3: 30,936,761	S403P	probably damaging	Het
Prl7b1	T	C	13: 27,604,533	E113G	probably damaging	Het
Qrich2	T	C	11: 116,455,330	D1556G	probably damaging	Het
Sept1	C	T	7: 127,217,704	V46M	probably benign	Het
Shank2	C	A	7: 144,052,460	Q127K	probably damaging	Het
Siah1a	A	G	8: 86,725,025	V277A	possibly damaging	Het
Slc4a7	T	A	14: 14,733,846	D85E	probably damaging	Het
Slc5a12	A	T	2: 110,641,810	I526F	probably damaging	Het
Svil	T	C	18: 5,063,231	V834A	possibly damaging	Het
Sycp1	T	A	3: 102,935,603	S17C	probably damaging	Het
Tmem2	T	C	19: 21,832,123	S956P	possibly damaging	Het
Tssk6	G	A	8: 69,903,023	R239Q	probably benign	Het
Txnrd1	A	G	10: 82,873,208	D80G	probably benign	Het
Tyk2	A	G	9: 21,124,954	F79S	probably damaging	Het
Tyrp1	T	C	4: 80,850,777	S503P	probably benign	Het
Upf1	A	T	8: 70,341,561	C232S	probably benign	Het
Zeb2	G	A	2: 44,988,910	T1080I	probably damaging	Het

Other mutations in Psmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Psmd2	APN	16	20659405	splice site	probably null
IGL02348:Psmd2	APN	16	20654647	missense	probably benign	0.07
IGL02352:Psmd2	APN	16	20656941	missense	probably benign	0.13
IGL02359:Psmd2	APN	16	20656941	missense	probably benign	0.13
R0012:Psmd2	UTSW	16	20661684	missense	probably damaging	0.99
R0144:Psmd2	UTSW	16	20662225	splice site	probably null
R0565:Psmd2	UTSW	16	20660426	missense	probably null	0.63
R0739:Psmd2	UTSW	16	20655329	missense	probably benign	0.01
R1075:Psmd2	UTSW	16	20659959	missense	probably damaging	0.98
R1189:Psmd2	UTSW	16	20661894	missense	probably benign	0.17
R1231:Psmd2	UTSW	16	20655585	missense	possibly damaging	0.83
R1405:Psmd2	UTSW	16	20652284	missense	possibly damaging	0.83
R1405:Psmd2	UTSW	16	20652284	missense	possibly damaging	0.83
R1466:Psmd2	UTSW	16	20657965	unclassified	probably benign
R1556:Psmd2	UTSW	16	20655585	missense	possibly damaging	0.83
R1843:Psmd2	UTSW	16	20656582	missense	probably benign	0.02
R2398:Psmd2	UTSW	16	20659472	missense	possibly damaging	0.86
R2421:Psmd2	UTSW	16	20660106	splice site	probably null
R2520:Psmd2	UTSW	16	20663076	missense	probably damaging	1.00
R3040:Psmd2	UTSW	16	20657567	missense	probably benign	0.08
R3905:Psmd2	UTSW	16	20655642	missense	probably benign	0.07
R3906:Psmd2	UTSW	16	20655642	missense	probably benign	0.07
R3909:Psmd2	UTSW	16	20655642	missense	probably benign	0.07
R4027:Psmd2	UTSW	16	20663205	missense	probably damaging	0.98
R4029:Psmd2	UTSW	16	20663205	missense	probably damaging	0.98
R4031:Psmd2	UTSW	16	20663205	missense	probably damaging	0.98
R4357:Psmd2	UTSW	16	20656652	missense	probably benign
R4410:Psmd2	UTSW	16	20655026	missense	probably damaging	0.96
R4678:Psmd2	UTSW	16	20659969	missense	probably damaging	1.00
R4737:Psmd2	UTSW	16	20659815	unclassified	probably benign
R4771:Psmd2	UTSW	16	20662679	missense	probably damaging	0.99
R5081:Psmd2	UTSW	16	20661655	missense	probably benign	0.14
R5124:Psmd2	UTSW	16	20652698	missense	possibly damaging	0.93
R5801:Psmd2	UTSW	16	20654922	missense	probably damaging	0.96
R6381:Psmd2	UTSW	16	20655273	missense	probably benign	0.03
R6732:Psmd2	UTSW	16	20662636	missense	probably benign	0.02
R7030:Psmd2	UTSW	16	20662133	missense	probably damaging	1.00
R7137:Psmd2	UTSW	16	20652627	missense	probably benign	0.12
R7432:Psmd2	UTSW	16	20654925	missense	probably damaging	0.99
R8673:Psmd2	UTSW	16	20656888	missense	probably damaging	1.00
R8685:Psmd2	UTSW	16	20655411	missense	probably benign
R9110:Psmd2	UTSW	16	20652244	missense	probably damaging	0.99
R9192:Psmd2	UTSW	16	20654662	missense	probably damaging	1.00
R9341:Psmd2	UTSW	16	20656691	critical splice donor site	probably null
R9343:Psmd2	UTSW	16	20656691	critical splice donor site	probably null
R9504:Psmd2	UTSW	16	20659410	missense	probably benign
R9526:Psmd2	UTSW	16	20655619	missense	probably benign	0.04
R9689:Psmd2	UTSW	16	20660423	missense	probably benign	0.05
Z1176:Psmd2	UTSW	16	20662660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCACGACTCAACATCCTGG -3'
(R):5'- GGAGACATGTTCCTTCTCAGG -3'

Sequencing Primer
(F):5'- CTGGATACGCTAAGCAAATTCTCTC -3'
(R):5'- GAGACATGTTCCTTCTCAGGCAAAC -3'

Posted On

2018-10-18