Incidental Mutation 'R6870:Psmd2'
ID536167
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 2
SynonymsTEG-190, Tex190, 9430095H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6870 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20651652-20663414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20661843 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 744 (M744R)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207]
Predicted Effect probably benign
Transcript: ENSMUST00000007212
AA Change: M744R

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: M744R

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 72% (39/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,136,408 Y62C probably benign Het
A1bg T C 15: 60,919,715 T291A probably damaging Het
Abcb11 A G 2: 69,285,298 I574T possibly damaging Het
Abcb5 T A 12: 118,965,265 Y17F possibly damaging Het
Arfgef3 A T 10: 18,646,730 L516* probably null Het
Arhgap21 A G 2: 20,880,510 S619P probably damaging Het
Atp2c1 A G 9: 105,470,062 V65A probably benign Het
Calm3 T A 7: 16,919,643 Q9L probably benign Het
Cd300c2 C T 11: 115,000,677 D124N probably damaging Het
Celsr3 A G 9: 108,829,191 T958A probably benign Het
Cfap69 T C 5: 5,621,958 T317A probably benign Het
Cluh T A 11: 74,665,384 I887K probably damaging Het
Dag1 A T 9: 108,209,258 V228E probably damaging Het
Dhtkd1 T C 2: 5,919,437 probably null Het
Dnah1 T A 14: 31,271,061 K2959* probably null Het
Dnttip2 T A 3: 122,275,808 V224E probably damaging Het
Drosha C T 15: 12,907,393 P1071L probably benign Het
E030025P04Rik T A 11: 109,140,167 H84L unknown Het
Elac2 A T 11: 64,999,763 S698C probably null Het
Elf2 A T 3: 51,294,165 *88R probably null Het
Fastkd1 T A 2: 69,708,614 I143L probably benign Het
Fbxw10 C T 11: 62,855,367 R366C probably damaging Het
Frg2f1 T C 4: 119,531,132 M57V probably benign Het
Gbp4 T C 5: 105,125,578 S129G probably damaging Het
Gnat2 A C 3: 108,095,631 probably benign Het
Golgb1 C A 16: 36,918,203 F2301L probably damaging Het
Il18bp T C 7: 102,017,311 T2A possibly damaging Het
Kpna2 T C 11: 106,992,694 probably null Het
Lrrfip2 A T 9: 111,216,119 probably benign Het
Map4k1 T G 7: 29,001,671 probably null Het
Mcm3ap T C 10: 76,470,215 V54A probably benign Het
Nup133 A G 8: 123,899,507 I1112T probably benign Het
Olfr906 A C 9: 38,488,086 D19A probably benign Het
Pcdhac1 T A 18: 37,092,087 V651D probably damaging Het
Pde10a A G 17: 8,967,524 T571A possibly damaging Het
Phc3 A G 3: 30,936,761 S403P probably damaging Het
Prl7b1 T C 13: 27,604,533 E113G probably damaging Het
Qrich2 T C 11: 116,455,330 D1556G probably damaging Het
Sept1 C T 7: 127,217,704 V46M probably benign Het
Shank2 C A 7: 144,052,460 Q127K probably damaging Het
Siah1a A G 8: 86,725,025 V277A possibly damaging Het
Slc4a7 T A 14: 14,733,846 D85E probably damaging Het
Slc5a12 A T 2: 110,641,810 I526F probably damaging Het
Svil T C 18: 5,063,231 V834A possibly damaging Het
Sycp1 T A 3: 102,935,603 S17C probably damaging Het
Tmem2 T C 19: 21,832,123 S956P possibly damaging Het
Tssk6 G A 8: 69,903,023 R239Q probably benign Het
Txnrd1 A G 10: 82,873,208 D80G probably benign Het
Tyk2 A G 9: 21,124,954 F79S probably damaging Het
Tyrp1 T C 4: 80,850,777 S503P probably benign Het
Upf1 A T 8: 70,341,561 C232S probably benign Het
Zeb2 G A 2: 44,988,910 T1080I probably damaging Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20659405 splice site probably null
IGL02348:Psmd2 APN 16 20654647 missense probably benign 0.07
IGL02352:Psmd2 APN 16 20656941 missense probably benign 0.13
IGL02359:Psmd2 APN 16 20656941 missense probably benign 0.13
R0012:Psmd2 UTSW 16 20661684 missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20662225 splice site probably null
R0565:Psmd2 UTSW 16 20660426 missense probably null 0.63
R0739:Psmd2 UTSW 16 20655329 missense probably benign 0.01
R1075:Psmd2 UTSW 16 20659959 missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20661894 missense probably benign 0.17
R1231:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20657965 unclassified probably benign
R1556:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20656582 missense probably benign 0.02
R2398:Psmd2 UTSW 16 20659472 missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20660106 splice site probably null
R2520:Psmd2 UTSW 16 20663076 missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20657567 missense probably benign 0.08
R3905:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3906:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3909:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R4027:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20656652 missense probably benign
R4410:Psmd2 UTSW 16 20655026 missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20659969 missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20659815 unclassified probably benign
R4771:Psmd2 UTSW 16 20662679 missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20661655 missense probably benign 0.14
R5124:Psmd2 UTSW 16 20652698 missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20654922 missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20655273 missense probably benign 0.03
R6732:Psmd2 UTSW 16 20662636 missense probably benign 0.02
R7030:Psmd2 UTSW 16 20662133 missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20652627 missense probably benign 0.12
R7432:Psmd2 UTSW 16 20654925 missense probably damaging 0.99
Z1176:Psmd2 UTSW 16 20662660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACGACTCAACATCCTGG -3'
(R):5'- GGAGACATGTTCCTTCTCAGG -3'

Sequencing Primer
(F):5'- CTGGATACGCTAAGCAAATTCTCTC -3'
(R):5'- GAGACATGTTCCTTCTCAGGCAAAC -3'
Posted On2018-10-18