Incidental Mutation 'R6872:Trim69'
ID 536188
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Name tripartite motif-containing 69
Synonyms 4921519C19Rik, Rnf36, Trif
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6872 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122160700-122179027 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122167910 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 121 (E121G)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
AlphaFold Q80X56
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036089
AA Change: E121G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: E121G

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Btbd2 C A 10: 80,644,332 R383L probably damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Ddo A C 10: 40,637,418 M119L possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr201 A G 16: 59,269,598 L23P probably benign Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
R8353:Trim69 UTSW 2 122168009 missense possibly damaging 0.73
R8551:Trim69 UTSW 2 122173329 missense probably benign 0.00
R9025:Trim69 UTSW 2 122173290 missense probably benign 0.03
R9075:Trim69 UTSW 2 122178783 missense probably benign 0.02
R9413:Trim69 UTSW 2 122178602 nonsense probably null
Z1176:Trim69 UTSW 2 122167554 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAACGACTGGTTCCGTGATCC -3'
(R):5'- GGCCCTCCAAAAGAATTTTCC -3'

Sequencing Primer
(F):5'- TGATCCGCTGATGCTGAC -3'
(R):5'- CTAAGGGATTTCTCAAGGCCCAG -3'
Posted On 2018-10-18