Incidental Mutation 'R6872:Gm436'
ID 536197
Institutional Source Beutler Lab
Gene Symbol Gm436
Ensembl Gene ENSMUSG00000078505
Gene Name predicted gene 436
Synonyms LOC230890
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6872 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 144669937-144686368 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 144670646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 172 (L172*)
Ref Sequence ENSEMBL: ENSMUSP00000101373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105747]
AlphaFold B1AVU6
Predicted Effect probably null
Transcript: ENSMUST00000105747
AA Change: L172*
SMART Domains Protein: ENSMUSP00000101373
Gene: ENSMUSG00000078505
AA Change: L172*

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 1.6e-29 PFAM
Pfam:Abhydrolase_3 292 381 9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Btbd2 C A 10: 80,644,332 R383L probably damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Ddo A C 10: 40,637,418 M119L possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr201 A G 16: 59,269,598 L23P probably benign Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Trim69 A G 2: 122,167,910 E121G probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Gm436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Gm436 APN 4 144673779 missense probably benign 0.12
IGL01369:Gm436 APN 4 144674645 missense possibly damaging 0.50
IGL01503:Gm436 APN 4 144674567 missense probably damaging 0.99
IGL01505:Gm436 APN 4 144674618 missense probably damaging 1.00
IGL01954:Gm436 APN 4 144670171 missense probably damaging 1.00
IGL02447:Gm436 APN 4 144674699 missense probably benign 0.02
IGL02804:Gm436 APN 4 144670439 missense possibly damaging 0.95
R0373:Gm436 UTSW 4 144686220 missense possibly damaging 0.54
R1124:Gm436 UTSW 4 144670275 missense probably benign 0.00
R1598:Gm436 UTSW 4 144670424 missense possibly damaging 0.60
R1734:Gm436 UTSW 4 144670026 missense probably benign 0.04
R1763:Gm436 UTSW 4 144669959 missense probably benign 0.24
R1968:Gm436 UTSW 4 144670623 missense possibly damaging 0.83
R3055:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3056:Gm436 UTSW 4 144674698 missense probably benign 0.16
R3930:Gm436 UTSW 4 144670128 missense probably damaging 1.00
R5124:Gm436 UTSW 4 144674719 missense probably damaging 1.00
R5407:Gm436 UTSW 4 144670325 missense probably benign 0.01
R6302:Gm436 UTSW 4 144670190 nonsense probably null
R6814:Gm436 UTSW 4 144670646 nonsense probably null
R6988:Gm436 UTSW 4 144686325 missense probably benign 0.01
R7131:Gm436 UTSW 4 144670067 missense probably damaging 0.98
R7895:Gm436 UTSW 4 144670343 missense possibly damaging 0.95
R8108:Gm436 UTSW 4 144670669 missense probably benign 0.04
R8378:Gm436 UTSW 4 144670599 missense probably benign 0.24
R8676:Gm436 UTSW 4 144670113 missense possibly damaging 0.94
R8817:Gm436 UTSW 4 144673791 missense probably benign 0.00
R9328:Gm436 UTSW 4 144674686 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAACAAGTCTTTGGAAAGAAGTGG -3'
(R):5'- CACGCTGAGGACTGAATCAG -3'

Sequencing Primer
(F):5'- TGGTAAAAGGAAATTAATGACCTGC -3'
(R):5'- TGAGGACTGAATCAGAATCAGTTACC -3'
Posted On 2018-10-18