Incidental Mutation 'R6872:Ddo'
ID536217
Institutional Source Beutler Lab
Gene Symbol Ddo
Ensembl Gene ENSMUSG00000063428
Gene NameD-aspartate oxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6872 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location40630011-40681847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40637418 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 119 (M119L)
Ref Sequence ENSEMBL: ENSMUSP00000019977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019977] [ENSMUST00000213442] [ENSMUST00000213503] [ENSMUST00000213856] [ENSMUST00000214102] [ENSMUST00000216830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019977
AA Change: M119L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019977
Gene: ENSMUSG00000063428
AA Change: M119L

DomainStartEndE-ValueType
Pfam:DAO 5 324 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213442
AA Change: M119L

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000213503
AA Change: M119L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect unknown
Transcript: ENSMUST00000213856
AA Change: R82S
Predicted Effect probably benign
Transcript: ENSMUST00000214102
AA Change: M128L

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216830
AA Change: M119L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peroxisomal flavoprotein that catalyzes the oxidative deamination of D-aspartate and N-methyl D-aspartate. Flavin adenine dinucleotide or 6-hydroxyflavin adenine dinucleotide can serve as the cofactor in this reaction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, but can display impaired male copulation, decreased autogrooming, increased body weight, and increased D-aspartate levels, depending on the mutant allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Btbd2 C A 10: 80,644,332 R383L probably damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr201 A G 16: 59,269,598 L23P probably benign Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Trim69 A G 2: 122,167,910 E121G probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Ddo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ddo APN 10 40647554 missense probably damaging 1.00
IGL01784:Ddo APN 10 40631788 splice site probably benign
IGL01891:Ddo APN 10 40647647 missense possibly damaging 0.95
IGL02559:Ddo APN 10 40647521 missense probably damaging 1.00
IGL02639:Ddo APN 10 40647737 missense probably damaging 1.00
IGL02884:Ddo APN 10 40637364 missense probably benign 0.01
R1796:Ddo UTSW 10 40647629 missense probably benign 0.32
R2512:Ddo UTSW 10 40632939 missense possibly damaging 0.56
R3054:Ddo UTSW 10 40631742 missense probably benign 0.37
R4454:Ddo UTSW 10 40647547 missense probably damaging 0.97
R5517:Ddo UTSW 10 40647730 missense probably benign 0.00
R6336:Ddo UTSW 10 40633031 missense probably damaging 0.98
R6516:Ddo UTSW 10 40631745 missense probably damaging 1.00
R7405:Ddo UTSW 10 40647997 missense possibly damaging 0.48
R7735:Ddo UTSW 10 40631774 missense probably benign 0.00
Z1176:Ddo UTSW 10 40647933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGTGAACGTCTGAAATC -3'
(R):5'- AAAGTCCCAGAGAGTCTGCTG -3'

Sequencing Primer
(F):5'- GCTGTGAACGTCTGAAATCTAGCTAC -3'
(R):5'- CAGAGAGTCTGCTGCGTGAG -3'
Posted On2018-10-18