Incidental Mutation 'R6872:Btbd2'
ID536218
Institutional Source Beutler Lab
Gene Symbol Btbd2
Ensembl Gene ENSMUSG00000003344
Gene NameBTB (POZ) domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6872 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80642617-80657071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80644332 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 383 (R383L)
Ref Sequence ENSEMBL: ENSMUSP00000120751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000079773] [ENSMUST00000085435] [ENSMUST00000126980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003434
AA Change: R398L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344
AA Change: R398L

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079773
SMART Domains Protein: ENSMUSP00000078706
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase 126 329 2e-19 PFAM
Pfam:Pkinase_Tyr 128 329 6.2e-10 PFAM
Pfam:CK1gamma_C 382 412 4e-11 PFAM
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085435
SMART Domains Protein: ENSMUSP00000082560
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 308 1.3e-14 PFAM
Pfam:Pkinase 46 313 7.6e-35 PFAM
Pfam:CK1gamma_C 354 385 1.2e-11 PFAM
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126980
AA Change: R383L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344
AA Change: R383L

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131876
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Ddo A C 10: 40,637,418 M119L possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr201 A G 16: 59,269,598 L23P probably benign Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Trim69 A G 2: 122,167,910 E121G probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Btbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
brachio UTSW 10 80645531 missense probably damaging 1.00
R0245:Btbd2 UTSW 10 80647806 missense probably damaging 1.00
R1794:Btbd2 UTSW 10 80643913 missense probably damaging 1.00
R1960:Btbd2 UTSW 10 80644705 missense probably benign 0.06
R4827:Btbd2 UTSW 10 80646389 missense probably damaging 1.00
R5197:Btbd2 UTSW 10 80646419 missense probably damaging 0.98
R5372:Btbd2 UTSW 10 80648641 missense probably damaging 0.99
R6108:Btbd2 UTSW 10 80645531 missense probably damaging 1.00
R6316:Btbd2 UTSW 10 80644778 missense probably damaging 0.98
R6355:Btbd2 UTSW 10 80645349 missense possibly damaging 0.81
R7016:Btbd2 UTSW 10 80648615 missense probably damaging 1.00
R7300:Btbd2 UTSW 10 80644266 missense probably damaging 1.00
R7524:Btbd2 UTSW 10 80646444 missense probably damaging 0.97
R7617:Btbd2 UTSW 10 80646392 missense probably damaging 1.00
R7756:Btbd2 UTSW 10 80648606 missense probably benign 0.05
R7762:Btbd2 UTSW 10 80643556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCGTATGGTATGCAGG -3'
(R):5'- ATCAGGTGAGAGCTTGGCAG -3'

Sequencing Primer
(F):5'- CCTTCGTATGGTATGCAGGGGATG -3'
(R):5'- TAGGTGAGACCCTTGTGCGC -3'
Posted On2018-10-18