Incidental Mutation 'R6872:Olfr201'
ID536233
Institutional Source Beutler Lab
Gene Symbol Olfr201
Ensembl Gene ENSMUSG00000074995
Gene Nameolfactory receptor 201
SynonymsGA_x54KRFPKG5P-55483936-55483010, MOR182-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6872 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59266113-59272632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59269598 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 23 (L23P)
Ref Sequence ENSEMBL: ENSMUSP00000150660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099656] [ENSMUST00000216834]
Predicted Effect probably benign
Transcript: ENSMUST00000099656
AA Change: L23P

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097248
Gene: ENSMUSG00000074995
AA Change: L23P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216834
AA Change: L23P

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Ap3d1 G A 10: 80,714,322 R692* probably null Het
Aqp2 C T 15: 99,584,004 H260Y probably benign Het
Btbd2 C A 10: 80,644,332 R383L probably damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Col12a1 A T 9: 79,677,234 N1357K probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Ddo A C 10: 40,637,418 M119L possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Eng T A 2: 32,673,275 I281N probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Gsdmc T C 15: 63,778,707 D275G possibly damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Lmod1 G T 1: 135,365,141 R578L probably damaging Het
Mindy2 A G 9: 70,616,762 probably null Het
Neb G T 2: 52,293,645 Q1004K probably damaging Het
Nkx2-9 T G 12: 56,611,889 N180T probably benign Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nol4l T C 2: 153,483,817 E116G probably damaging Het
Olfr366 A T 2: 37,219,977 M163L possibly damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Ramp3 T C 11: 6,674,768 C21R possibly damaging Het
Rpap1 A C 2: 119,775,369 M345R probably damaging Het
Serpina3k A C 12: 104,344,260 K350Q probably benign Het
St13 C T 15: 81,366,346 probably null Het
Stard9 A T 2: 120,714,068 K4497* probably null Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Trim69 A G 2: 122,167,910 E121G probably damaging Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zbtb7a A G 10: 81,148,071 N449S possibly damaging Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp462 G A 4: 55,012,326 A1431T probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Zfp706 T C 15: 37,001,946 T46A possibly damaging Het
Other mutations in Olfr201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr201 APN 16 59268850 missense probably benign 0.07
IGL01985:Olfr201 APN 16 59269079 missense probably benign
IGL02618:Olfr201 APN 16 59268927 missense probably damaging 1.00
IGL02830:Olfr201 APN 16 59269053 missense possibly damaging 0.94
PIT4449001:Olfr201 UTSW 16 59269130 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R1035:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1037:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1163:Olfr201 UTSW 16 59269155 missense probably benign 0.23
R1225:Olfr201 UTSW 16 59269224 missense probably benign
R1519:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1583:Olfr201 UTSW 16 59269031 missense probably benign 0.00
R2075:Olfr201 UTSW 16 59268911 missense possibly damaging 0.60
R4591:Olfr201 UTSW 16 59269413 missense possibly damaging 0.94
R5547:Olfr201 UTSW 16 59269116 missense probably benign 0.35
R6132:Olfr201 UTSW 16 59269004 missense probably damaging 0.97
R6737:Olfr201 UTSW 16 59268812 missense possibly damaging 0.60
R8001:Olfr201 UTSW 16 59269109 missense probably benign 0.01
R8525:Olfr201 UTSW 16 59269208 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACTCAACCAGGGTTATCTCATG -3'
(R):5'- CTGGCATTAGAAATTTCCATTTGGG -3'

Sequencing Primer
(F):5'- TGAGAATCATTCTGGGAGTCAC -3'
(R):5'- CCATTTGGGATAGTGACAGTGATAAC -3'
Posted On2018-10-18