Incidental Mutation 'R6873:Gm13762'
ID536240
Institutional Source Beutler Lab
Gene Symbol Gm13762
Ensembl Gene ENSMUSG00000075111
Gene Namepredicted gene 13762
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6873 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88972055-88980281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88973424 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 156 (T156A)
Ref Sequence ENSEMBL: ENSMUSP00000126588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144908] [ENSMUST00000168169]
Predicted Effect probably benign
Transcript: ENSMUST00000144908
AA Change: T156A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000168169
AA Change: T156A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126588
Gene: ENSMUSG00000075111
AA Change: T156A

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 1.8e-26 PFAM
Pfam:7tm_4 138 282 3.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Gm13762
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0240:Gm13762 UTSW 2 88973396 missense probably damaging 1.00
R1446:Gm13762 UTSW 2 88973765 missense probably benign 0.00
R1845:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R1868:Gm13762 UTSW 2 88973784 missense possibly damaging 0.60
R1953:Gm13762 UTSW 2 88973880 nonsense probably null
R4205:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R4751:Gm13762 UTSW 2 88973133 missense probably damaging 1.00
R4895:Gm13762 UTSW 2 88973711 missense probably benign 0.39
R4937:Gm13762 UTSW 2 88973490 missense probably damaging 1.00
R5621:Gm13762 UTSW 2 88973466 missense probably benign 0.00
R5678:Gm13762 UTSW 2 88972973 nonsense probably null
R5938:Gm13762 UTSW 2 88973013 missense probably benign 0.00
R6021:Gm13762 UTSW 2 88973032 nonsense probably null
R6180:Gm13762 UTSW 2 88973882 missense probably damaging 1.00
R6724:Gm13762 UTSW 2 88973268 missense probably benign 0.02
R6893:Gm13762 UTSW 2 88973799 missense probably benign 0.00
R7221:Gm13762 UTSW 2 88973153 missense probably damaging 0.99
R7634:Gm13762 UTSW 2 88973657 missense probably damaging 1.00
R8233:Gm13762 UTSW 2 88973738 missense probably benign
R8262:Gm13762 UTSW 2 88973208 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCTGTACTGTGAGTTCTCAAAGAG -3'
(R):5'- GGCACAAGTCTTTGCTGTGC -3'

Sequencing Primer
(F):5'- TGACACCATAGGAAATAAGCAACAAG -3'
(R):5'- ACAAGTCTTTGCTGTGCACTTC -3'
Posted On2018-10-18