Mutagenetix > Incidental Mutations

Incidental Mutation 'R6873:Igsf10'

536243

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene?

Possibly non essential (E-score: 0.306) question?

Stock #

R6873 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59328444 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1439 (A1439T)

Ref Sequence

ENSEMBL: ENSMUSP00000141391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]

Predicted Effect

probably benign
Transcript: ENSMUST00000039419
AA Change: A1439T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: A1439T

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193455
AA Change: A1439T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: A1439T

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194546
AA Change: A1439T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: A1439T

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (48/49)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adssl1	A	G	12: 112,632,704	D123G	probably benign	Het
Agbl4	A	G	4: 111,566,659	D294G	possibly damaging	Het
Apob	G	T	12: 8,015,995	M4288I	probably benign	Het
Arnt	T	G	3: 95,474,575	F160V	probably damaging	Het
Atp5a1	C	T	18: 77,775,840	R42*	probably null	Het
Bhlha15	A	G	5: 144,191,385	D105G	probably benign	Het
C6	A	G	15: 4,790,979	T491A	probably benign	Het
Caskin1	A	G	17: 24,504,179	E647G	probably benign	Het
Col11a2	A	G	17: 34,065,019	D1579G	unknown	Het
Dctn2	T	G	10: 127,276,236		probably null	Het
Eqtn	A	G	4: 94,927,021	V80A	probably damaging	Het
Etl4	A	G	2: 20,797,992		probably null	Het
Fam26e	G	C	10: 34,092,452	R202G	probably damaging	Het
Fbxo10	T	C	4: 45,041,787	D814G	possibly damaging	Het
Galnt10	A	G	11: 57,781,219	D445G	probably damaging	Het
Gm13762	T	C	2: 88,973,424	T156A	probably benign	Het
Gm6309	T	C	5: 146,168,188	D305G	probably damaging	Het
Grap2	G	A	15: 80,643,673	V107I	probably damaging	Het
Krt5	G	A	15: 101,712,877		probably benign	Het
Lancl2	A	G	6: 57,722,657	I152M	possibly damaging	Het
Mast3	A	T	8: 70,786,592	C447*	probably null	Het
Mef2b	A	G	8: 70,166,307	I180V	probably benign	Het
Mon1b	T	C	8: 113,642,065	Y533H	probably damaging	Het
Mst1r	A	T	9: 107,911,644	H454L	possibly damaging	Het
Nhlrc4	G	A	17: 25,943,522	Q84*	probably null	Het
Nlk	A	G	11: 78,590,948	I229T	possibly damaging	Het
Nlrp6	T	C	7: 140,923,520	I513T	probably benign	Het
Olfr134	A	T	17: 38,175,368	M95L	probably benign	Het
Olfr340	A	T	2: 36,453,496	I304F	probably benign	Het
Panx1	A	T	9: 15,010,217	Y121N	probably damaging	Het
Pfkfb4	A	C	9: 109,010,335		probably null	Het
Setbp1	A	G	18: 78,859,559	S298P	probably benign	Het
Sh3bgr	A	C	16: 96,206,491	K19Q	probably damaging	Het
Slc35c2	T	C	2: 165,282,809	D82G	possibly damaging	Het
Spata13	T	A	14: 60,691,957	D321E	probably benign	Het
Stab2	A	G	10: 86,861,366		probably null	Het
Sulf2	T	A	2: 166,089,275	I271F	probably damaging	Het
Sult2a5	A	T	7: 13,625,386	I96L	probably benign	Het
Sv2b	A	G	7: 75,206,206	F112S	probably damaging	Het
Sycp1	G	A	3: 102,840,980	T832I	probably benign	Het
Tm9sf2	A	T	14: 122,145,113	E179V	probably damaging	Het
Tmem209	A	G	6: 30,508,456	I66T	probably damaging	Het
Tspan10	T	C	11: 120,444,723	W220R	probably damaging	Het
Ttc39b	G	C	4: 83,246,276	N266K	probably damaging	Het
Uri1	A	T	7: 37,965,339	D309E	probably benign	Het
Zfhx3	C	T	8: 108,800,641	R1057W	probably damaging	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2913:Igsf10	UTSW	3	59331736	missense	possibly damaging	0.70
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7251:Igsf10	UTSW	3	59319454	missense	probably damaging	1.00
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7678:Igsf10	UTSW	3	59319340	missense	possibly damaging	0.81
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8350:Igsf10	UTSW	3	59331528	missense	probably damaging	1.00
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCAGTGGATCCAGTTAAGATC -3'
(R):5'- TTCCCCGGGAAAAGTCACTG -3'

Sequencing Primer
(F):5'- TCAGTGGATCCAGTTAAGATCTCAGG -3'
(R):5'- GTCACTGGTAGGACTGTAAGTAC -3'

Posted On

2018-10-18