Incidental Mutation 'R6873:Sycp1'
ID536245
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R6873 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102840980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 832 (T832I)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
Predicted Effect probably benign
Transcript: ENSMUST00000029448
AA Change: T832I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: T832I

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196988
AA Change: T832I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: T832I

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCATGCTGAAAGGTCTTTGC -3'
(R):5'- ATTTTCTCACAATTGGAGCAGATGC -3'

Sequencing Primer
(F):5'- GGTAAAATGCTTTTGGCAGAT -3'
(R):5'- GAGCAGATGCCCATTTTTCAG -3'
Posted On2018-10-18