Incidental Mutation 'R6873:Ttc39b'
ID536247
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6873 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 83246276 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 266 (N266K)
Ref Sequence ENSEMBL: ENSMUSP00000099887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048274] [ENSMUST00000102823]
Predicted Effect probably damaging
Transcript: ENSMUST00000048274
AA Change: N266K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040590
Gene: ENSMUSG00000038172
AA Change: N266K

DomainStartEndE-ValueType
Pfam:DUF3808 75 478 2.2e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102823
AA Change: N266K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172
AA Change: N266K

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0536:Ttc39b UTSW 4 83227198 missense probably damaging 1.00
R0654:Ttc39b UTSW 4 83241701 missense probably benign 0.03
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5360:Ttc39b UTSW 4 83261847 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R7274:Ttc39b UTSW 4 83261851 missense possibly damaging 0.95
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
R7536:Ttc39b UTSW 4 83239978 nonsense probably null
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACACTTGCGCCTCATTTGGG -3'
(R):5'- TAGACTTGATTTGGCTTCCAGG -3'

Sequencing Primer
(F):5'- CGCCTCATTTGGGGAAGTATG -3'
(R):5'- TTGAACAGGTTAGGGTTAGCCAC -3'
Posted On2018-10-18