Incidental Mutation 'R6873:Sv2b'
ID536256
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Namesynaptic vesicle glycoprotein 2 b
SynonymsA830038F04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6873 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location75114894-75309262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75206206 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 112 (F112S)
Ref Sequence ENSEMBL: ENSMUSP00000146049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
Predicted Effect probably damaging
Transcript: ENSMUST00000085164
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: F112S

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165175
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: F112S

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206344
AA Change: F112S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75136455 missense probably damaging 1.00
IGL02302:Sv2b APN 7 75124199 missense probably damaging 0.98
IGL02352:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02359:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02698:Sv2b APN 7 75140978 critical splice donor site probably null
IGL02713:Sv2b APN 7 75124163 missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75136320 missense probably benign
IGL03392:Sv2b APN 7 75156760 critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75125641 missense probably damaging 1.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0219:Sv2b UTSW 7 75157267 critical splice donor site probably null
R0277:Sv2b UTSW 7 75206439 missense possibly damaging 0.62
R0469:Sv2b UTSW 7 75136392 missense probably benign
R0510:Sv2b UTSW 7 75136392 missense probably benign
R1219:Sv2b UTSW 7 75136412 missense probably benign 0.01
R1307:Sv2b UTSW 7 75206434 missense probably damaging 1.00
R1476:Sv2b UTSW 7 75120043 missense possibly damaging 0.72
R1520:Sv2b UTSW 7 75157329 missense probably damaging 0.98
R1575:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1585:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1666:Sv2b UTSW 7 75206341 missense probably benign 0.01
R1712:Sv2b UTSW 7 75149059 missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75124080 missense probably benign 0.17
R1993:Sv2b UTSW 7 75206341 missense probably benign 0.01
R2191:Sv2b UTSW 7 75124088 missense probably damaging 1.00
R3836:Sv2b UTSW 7 75157428 missense probably damaging 1.00
R4744:Sv2b UTSW 7 75206518 missense probably benign 0.01
R4757:Sv2b UTSW 7 75124170 missense probably benign 0.31
R4924:Sv2b UTSW 7 75136421 missense probably benign 0.20
R4990:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75157425 missense probably damaging 1.00
R5726:Sv2b UTSW 7 75124214 missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75156753 missense probably damaging 1.00
R6379:Sv2b UTSW 7 75136300 missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75140109 missense probably benign 0.40
R6623:Sv2b UTSW 7 75206384 missense probably damaging 1.00
R6709:Sv2b UTSW 7 75124139 missense probably benign 0.40
R6889:Sv2b UTSW 7 75125767 intron probably null
R7123:Sv2b UTSW 7 75117702 missense possibly damaging 0.94
R7278:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7363:Sv2b UTSW 7 75147654 missense probably damaging 0.99
R7378:Sv2b UTSW 7 75147728 critical splice acceptor site probably null
R7426:Sv2b UTSW 7 75124064 missense probably damaging 1.00
R7452:Sv2b UTSW 7 75147713 missense probably damaging 1.00
R7504:Sv2b UTSW 7 75136383 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTGCAGGATATCCAACAGTGAC -3'
(R):5'- TCCAGATGATGTCAAGTCTAAGC -3'

Sequencing Primer
(F):5'- CCAACAGTGACAAGCTATACGTGTG -3'
(R):5'- TCTAAGCAGACCAAGATGGCGC -3'
Posted On2018-10-18