Mutagenetix > Incidental Mutation

Incidental Mutation 'R6873:Nlrp6'

536257

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6873 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140923520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 513 (I513T)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

probably benign
Transcript: ENSMUST00000106045
AA Change: I483T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: I483T

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000183845
AA Change: I483T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: I483T

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000184560
AA Change: I513T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: I513T

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adssl1	A	G	12: 112,632,704	D123G	probably benign	Het
Agbl4	A	G	4: 111,566,659	D294G	possibly damaging	Het
Apob	G	T	12: 8,015,995	M4288I	probably benign	Het
Arnt	T	G	3: 95,474,575	F160V	probably damaging	Het
Atp5a1	C	T	18: 77,775,840	R42*	probably null	Het
Bhlha15	A	G	5: 144,191,385	D105G	probably benign	Het
C6	A	G	15: 4,790,979	T491A	probably benign	Het
Caskin1	A	G	17: 24,504,179	E647G	probably benign	Het
Col11a2	A	G	17: 34,065,019	D1579G	unknown	Het
Dctn2	T	G	10: 127,276,236		probably null	Het
Eqtn	A	G	4: 94,927,021	V80A	probably damaging	Het
Etl4	A	G	2: 20,797,992		probably null	Het
Fam26e	G	C	10: 34,092,452	R202G	probably damaging	Het
Fbxo10	T	C	4: 45,041,787	D814G	possibly damaging	Het
Galnt10	A	G	11: 57,781,219	D445G	probably damaging	Het
Gm13762	T	C	2: 88,973,424	T156A	probably benign	Het
Gm6309	T	C	5: 146,168,188	D305G	probably damaging	Het
Grap2	G	A	15: 80,643,673	V107I	probably damaging	Het
Igsf10	C	T	3: 59,328,444	A1439T	probably benign	Het
Krt5	G	A	15: 101,712,877		probably benign	Het
Lancl2	A	G	6: 57,722,657	I152M	possibly damaging	Het
Mast3	A	T	8: 70,786,592	C447*	probably null	Het
Mef2b	A	G	8: 70,166,307	I180V	probably benign	Het
Mon1b	T	C	8: 113,642,065	Y533H	probably damaging	Het
Mst1r	A	T	9: 107,911,644	H454L	possibly damaging	Het
Nhlrc4	G	A	17: 25,943,522	Q84*	probably null	Het
Nlk	A	G	11: 78,590,948	I229T	possibly damaging	Het
Olfr134	A	T	17: 38,175,368	M95L	probably benign	Het
Olfr340	A	T	2: 36,453,496	I304F	probably benign	Het
Panx1	A	T	9: 15,010,217	Y121N	probably damaging	Het
Pfkfb4	A	C	9: 109,010,335		probably null	Het
Setbp1	A	G	18: 78,859,559	S298P	probably benign	Het
Sh3bgr	A	C	16: 96,206,491	K19Q	probably damaging	Het
Slc35c2	T	C	2: 165,282,809	D82G	possibly damaging	Het
Spata13	T	A	14: 60,691,957	D321E	probably benign	Het
Stab2	A	G	10: 86,861,366		probably null	Het
Sulf2	T	A	2: 166,089,275	I271F	probably damaging	Het
Sult2a5	A	T	7: 13,625,386	I96L	probably benign	Het
Sv2b	A	G	7: 75,206,206	F112S	probably damaging	Het
Sycp1	G	A	3: 102,840,980	T832I	probably benign	Het
Tm9sf2	A	T	14: 122,145,113	E179V	probably damaging	Het
Tmem209	A	G	6: 30,508,456	I66T	probably damaging	Het
Tspan10	T	C	11: 120,444,723	W220R	probably damaging	Het
Ttc39b	G	C	4: 83,246,276	N266K	probably damaging	Het
Uri1	A	T	7: 37,965,339	D309E	probably benign	Het
Zfhx3	C	T	8: 108,800,641	R1057W	probably damaging	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCAGCATGCTGAAGTCTG -3'
(R):5'- AGCCCCTCTGTATTTAGCAGG -3'

Sequencing Primer
(F):5'- CTGAAGTCTGCAGGCACCAATG -3'
(R):5'- CCTCTGTATTTAGCAGGCCAAAGAG -3'

Posted On

2018-10-18