Incidental Mutation 'R6873:Tm9sf2'
ID 536274
Institutional Source Beutler Lab
Gene Symbol Tm9sf2
Ensembl Gene ENSMUSG00000025544
Gene Name transmembrane 9 superfamily member 2
Synonyms D14Ertd64e, P76, 1500001N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock # R6873 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 122107038-122159604 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122145113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 179 (E179V)
Ref Sequence ENSEMBL: ENSMUSP00000131227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026624] [ENSMUST00000171318]
AlphaFold P58021
Predicted Effect probably damaging
Transcript: ENSMUST00000026624
AA Change: E344V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026624
Gene: ENSMUSG00000025544
AA Change: E344V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 74 619 4.5e-209 PFAM
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171318
AA Change: E179V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131227
Gene: ENSMUSG00000025544
AA Change: E179V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 73 112 5.9e-9 PFAM
Pfam:EMP70 109 455 1e-172 PFAM
transmembrane domain 465 487 N/A INTRINSIC
Meta Mutation Damage Score 0.5825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mast3 A T 8: 70,786,592 C447* probably null Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Tm9sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Tm9sf2 APN 14 122143460 missense probably damaging 1.00
IGL01995:Tm9sf2 APN 14 122143471 missense probably benign 0.25
IGL02173:Tm9sf2 APN 14 122143423 missense probably benign 0.13
IGL02249:Tm9sf2 APN 14 122123750 missense probably damaging 1.00
IGL02328:Tm9sf2 APN 14 122143430 missense possibly damaging 0.79
IGL03231:Tm9sf2 APN 14 122141252 missense possibly damaging 0.95
R0367:Tm9sf2 UTSW 14 122155368 missense probably benign 0.06
R1959:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
R2251:Tm9sf2 UTSW 14 122139731 missense probably benign
R2504:Tm9sf2 UTSW 14 122158684 missense probably benign 0.01
R4791:Tm9sf2 UTSW 14 122139650 missense probably benign 0.00
R4795:Tm9sf2 UTSW 14 122149840 splice site probably null
R4851:Tm9sf2 UTSW 14 122141204 missense probably benign 0.00
R5063:Tm9sf2 UTSW 14 122145146 missense probably damaging 1.00
R5117:Tm9sf2 UTSW 14 122143501 missense probably benign 0.30
R5443:Tm9sf2 UTSW 14 122126195 missense probably damaging 0.97
R5677:Tm9sf2 UTSW 14 122151962 critical splice acceptor site probably null
R5966:Tm9sf2 UTSW 14 122137509 intron probably benign
R6465:Tm9sf2 UTSW 14 122141207 missense probably benign 0.16
R7403:Tm9sf2 UTSW 14 122141228 missense probably benign 0.33
R7531:Tm9sf2 UTSW 14 122142412 missense possibly damaging 0.49
R8176:Tm9sf2 UTSW 14 122137501 missense probably benign 0.01
R8447:Tm9sf2 UTSW 14 122139768 missense probably damaging 1.00
R8773:Tm9sf2 UTSW 14 122143471 missense probably benign 0.21
R9039:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGGCAGTTTTCCGATGACTGTAG -3'
(R):5'- GCTACTTTTGGGAAGGAAAACTCC -3'

Sequencing Primer
(F):5'- CCGATGACTGTAGACTTCAGTAC -3'
(R):5'- CTTACACAGAGTTACAAAAGTC -3'
Posted On 2018-10-18