Incidental Mutation 'R6874:Vmn2r1'
ID536294
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Namevomeronasal 2, receptor 1
SynonymsEG56544, V2r83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6874 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64081642-64105458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64104955 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 746 (C746S)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
Predicted Effect probably damaging
Transcript: ENSMUST00000029406
AA Change: C746S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: C746S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0305:Vmn2r1 UTSW 3 64089666 missense probably damaging 1.00
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6464:Vmn2r1 UTSW 3 64101345 missense probably benign
R6826:Vmn2r1 UTSW 3 64105146 nonsense probably null
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense probably damaging 1.00
R7557:Vmn2r1 UTSW 3 64090054 missense probably damaging 0.99
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTTCATAGGCAAGCCATG -3'
(R):5'- AATAGTTATCTGGCAGCTGGCG -3'

Sequencing Primer
(F):5'- AAGCCATGCAACTGGTCCTG -3'
(R):5'- CTGGCGAGCCACAAAGGTTG -3'
Posted On2018-10-18