Incidental Mutation 'R6874:Muc16'
ID536317
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6874 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 18658769 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 818 (S818*)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000208663
AA Change: S818*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCCATGCTGTCCTCAAGG -3'
(R):5'- ATTCAGTTTGGGAAGGGTCC -3'

Sequencing Primer
(F):5'- CCTTTCAGATGAGACTGACTGTGAAG -3'
(R):5'- GAAGGGTCCATGCCTACAAGTTC -3'
Posted On2018-10-18