Mutagenetix > Incidental Mutations

Incidental Mutation 'R6874:Muc16'

536317

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R6874 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 18658769 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 818 (S818*)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably null
Transcript: ENSMUST00000208663
AA Change: S818*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	G	7: 120,252,205	D802G	possibly damaging	Het
Acsl5	A	G	19: 55,291,863	T523A	probably damaging	Het
Adamts7	A	T	9: 90,188,731	D635V	probably damaging	Het
Akr1c12	C	A	13: 4,272,960	G217C	probably benign	Het
Astn1	C	A	1: 158,664,074	S1007*	probably null	Het
Cntln	T	C	4: 85,067,759	L988P	probably damaging	Het
Dcps	A	T	9: 35,175,967	M1K	probably null	Het
Dnaic1	T	A	4: 41,632,412	L582Q	probably damaging	Het
Dst	A	T	1: 34,289,651	Q7118L	probably benign	Het
Ehd2	T	A	7: 15,950,438	T479S	probably benign	Het
Fbxl7	T	C	15: 26,552,942	I80V	probably benign	Het
Fry	T	C	5: 150,437,303	V125A	probably benign	Het
Gm12695	A	T	4: 96,785,069	I31K	probably benign	Het
Gm5591	T	C	7: 38,520,291	E386G	probably damaging	Het
Helz	G	T	11: 107,663,634	R1219S	probably damaging	Het
Hes3	G	T	4: 152,287,238	P85T	possibly damaging	Het
Igkv3-2	A	T	6: 70,698,838	R44*	probably null	Het
Igsf9	A	G	1: 172,494,529	T496A	probably benign	Het
Irf2bp1	G	T	7: 19,005,217	A261S	possibly damaging	Het
Jph2	G	A	2: 163,339,487	P586S	probably benign	Het
Klhl11	T	C	11: 100,472,205	H175R	probably benign	Het
Ksr2	G	T	5: 117,756,336	E847*	probably null	Het
Lats1	T	A	10: 7,710,851	Y926N	probably damaging	Het
Lmbr1	A	T	5: 29,292,906	L33H	probably damaging	Het
Lrp10	T	C	14: 54,468,213	S287P	possibly damaging	Het
Map3k6	G	A	4: 133,250,656	E976K	probably benign	Het
Mfsd6	T	A	1: 52,660,709	D760V	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Nagpa	T	C	16: 5,196,057	T306A	probably benign	Het
Nisch	G	T	14: 31,176,684		probably benign	Het
Nrxn3	T	C	12: 90,332,190	V1028A	probably damaging	Het
Nucb1	T	C	7: 45,503,194	N75S	probably benign	Het
Olfr1058	C	T	2: 86,385,528	V297I	possibly damaging	Het
Olfr191	T	A	16: 59,085,949	Y178F	probably benign	Het
Olfr396-ps1	T	G	11: 73,928,242	M6R	probably null	Het
Olfr644	T	A	7: 104,068,189	I281F	possibly damaging	Het
Olfr832	T	A	9: 18,945,481	Y278N	possibly damaging	Het
Olfr96	T	C	17: 37,225,347	V74A	probably benign	Het
Olfr983	A	G	9: 40,092,726	V80A	probably benign	Het
Pik3c2a	A	G	7: 116,394,305	L409S	probably damaging	Het
Pkhd1l1	T	A	15: 44,589,527	D3949E	probably benign	Het
Prune2	C	A	19: 17,123,228	P2032Q	probably damaging	Het
Ptms	T	C	6: 124,914,231		probably benign	Het
Ptp4a3	A	G	15: 73,723,410		probably benign	Het
Ptprq	T	C	10: 107,718,599	I88M	possibly damaging	Het
Radil	T	A	5: 142,506,802	D357V	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Supt20	A	G	3: 54,727,754		probably null	Het
Thoc5	T	C	11: 4,901,261	I69T	probably damaging	Het
Trib2	G	C	12: 15,815,337	S79W	probably damaging	Het
Trpc6	A	G	9: 8,680,438	D889G	probably damaging	Het
Usf3	T	C	16: 44,219,740	S1528P	probably benign	Het
Vax1	A	T	19: 59,168,523	V126E	unknown	Het
Vgf	A	G	5: 137,031,532		probably benign	Het
Vmn2r1	T	A	3: 64,104,955	C746S	probably damaging	Het
Vmn2r77	A	G	7: 86,802,078	T391A	probably benign	Het
Zfp738	C	A	13: 67,670,263	E536D	possibly damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGTCCATGCTGTCCTCAAGG -3'
(R):5'- ATTCAGTTTGGGAAGGGTCC -3'

Sequencing Primer
(F):5'- CCTTTCAGATGAGACTGACTGTGAAG -3'
(R):5'- GAAGGGTCCATGCCTACAAGTTC -3'

Posted On

2018-10-18