Mutagenetix > Incidental Mutation

Incidental Mutation 'R6874:Lats1'

536322

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R6874 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7710851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 926 (Y926N)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: Y926N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Y926N

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: Y926N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Y926N

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: Y926N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	G	7: 120,252,205	D802G	possibly damaging	Het
Acsl5	A	G	19: 55,291,863	T523A	probably damaging	Het
Adamts7	A	T	9: 90,188,731	D635V	probably damaging	Het
Akr1c12	C	A	13: 4,272,960	G217C	probably benign	Het
Astn1	C	A	1: 158,664,074	S1007*	probably null	Het
Cntln	T	C	4: 85,067,759	L988P	probably damaging	Het
Dcps	A	T	9: 35,175,967	M1K	probably null	Het
Dnaic1	T	A	4: 41,632,412	L582Q	probably damaging	Het
Dst	A	T	1: 34,289,651	Q7118L	probably benign	Het
Ehd2	T	A	7: 15,950,438	T479S	probably benign	Het
Fbxl7	T	C	15: 26,552,942	I80V	probably benign	Het
Fry	T	C	5: 150,437,303	V125A	probably benign	Het
Gm12695	A	T	4: 96,785,069	I31K	probably benign	Het
Gm5591	T	C	7: 38,520,291	E386G	probably damaging	Het
Helz	G	T	11: 107,663,634	R1219S	probably damaging	Het
Hes3	G	T	4: 152,287,238	P85T	possibly damaging	Het
Igkv3-2	A	T	6: 70,698,838	R44*	probably null	Het
Igsf9	A	G	1: 172,494,529	T496A	probably benign	Het
Irf2bp1	G	T	7: 19,005,217	A261S	possibly damaging	Het
Jph2	G	A	2: 163,339,487	P586S	probably benign	Het
Klhl11	T	C	11: 100,472,205	H175R	probably benign	Het
Ksr2	G	T	5: 117,756,336	E847*	probably null	Het
Lmbr1	A	T	5: 29,292,906	L33H	probably damaging	Het
Lrp10	T	C	14: 54,468,213	S287P	possibly damaging	Het
Map3k6	G	A	4: 133,250,656	E976K	probably benign	Het
Mfsd6	T	A	1: 52,660,709	D760V	probably benign	Het
Muc16	G	T	9: 18,658,769	S818*	probably null	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Nagpa	T	C	16: 5,196,057	T306A	probably benign	Het
Nisch	G	T	14: 31,176,684		probably benign	Het
Nrxn3	T	C	12: 90,332,190	V1028A	probably damaging	Het
Nucb1	T	C	7: 45,503,194	N75S	probably benign	Het
Olfr1058	C	T	2: 86,385,528	V297I	possibly damaging	Het
Olfr191	T	A	16: 59,085,949	Y178F	probably benign	Het
Olfr396-ps1	T	G	11: 73,928,242	M6R	probably null	Het
Olfr644	T	A	7: 104,068,189	I281F	possibly damaging	Het
Olfr832	T	A	9: 18,945,481	Y278N	possibly damaging	Het
Olfr96	T	C	17: 37,225,347	V74A	probably benign	Het
Olfr983	A	G	9: 40,092,726	V80A	probably benign	Het
Pik3c2a	A	G	7: 116,394,305	L409S	probably damaging	Het
Pkhd1l1	T	A	15: 44,589,527	D3949E	probably benign	Het
Prune2	C	A	19: 17,123,228	P2032Q	probably damaging	Het
Ptms	T	C	6: 124,914,231		probably benign	Het
Ptp4a3	A	G	15: 73,723,410		probably benign	Het
Ptprq	T	C	10: 107,718,599	I88M	possibly damaging	Het
Radil	T	A	5: 142,506,802	D357V	probably damaging	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Supt20	A	G	3: 54,727,754		probably null	Het
Thoc5	T	C	11: 4,901,261	I69T	probably damaging	Het
Trib2	G	C	12: 15,815,337	S79W	probably damaging	Het
Trpc6	A	G	9: 8,680,438	D889G	probably damaging	Het
Usf3	T	C	16: 44,219,740	S1528P	probably benign	Het
Vax1	A	T	19: 59,168,523	V126E	unknown	Het
Vgf	A	G	5: 137,031,532		probably benign	Het
Vmn2r1	T	A	3: 64,104,955	C746S	probably damaging	Het
Vmn2r77	A	G	7: 86,802,078	T391A	probably benign	Het
Zfp738	C	A	13: 67,670,263	E536D	possibly damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGAAGTGCTACTGCGAAC -3'
(R):5'- CATGAGTACGAGAGCACACTTG -3'

Sequencing Primer
(F):5'- AGCAGCCAACCTTACTTT -3'
(R):5'- GCACACTTGAAGATTCACGGTTG -3'

Posted On

2018-10-18