Incidental Mutation 'R6874:Klhl11'
ID536326
Institutional Source Beutler Lab
Gene Symbol Klhl11
Ensembl Gene ENSMUSG00000048732
Gene Namekelch-like 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R6874 (G1)
Quality Score221.009
Status Not validated
Chromosome11
Chromosomal Location100462614-100472741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100472205 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 175 (H175R)
Ref Sequence ENSEMBL: ENSMUSP00000054963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000056665] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056665
AA Change: H175R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000054963
Gene: ENSMUSG00000048732
AA Change: H175R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
BTB 95 201 2.69e-21 SMART
BACK 206 308 9.54e-26 SMART
Kelch 361 408 4.1e0 SMART
Kelch 409 454 2.61e-1 SMART
Kelch 455 502 2.17e-1 SMART
Kelch 611 662 1.39e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107389
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165111
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Klhl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhl11 APN 11 100463205 missense possibly damaging 0.94
IGL02334:Klhl11 APN 11 100463836 missense probably damaging 1.00
IGL02886:Klhl11 APN 11 100472221 missense possibly damaging 0.92
R0372:Klhl11 UTSW 11 100463522 missense probably damaging 0.97
R0583:Klhl11 UTSW 11 100464324 missense possibly damaging 0.57
R0608:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R0609:Klhl11 UTSW 11 100463714 missense probably damaging 1.00
R1417:Klhl11 UTSW 11 100472289 missense probably benign 0.00
R1629:Klhl11 UTSW 11 100464186 missense probably benign 0.00
R1643:Klhl11 UTSW 11 100463015 missense probably benign 0.09
R1985:Klhl11 UTSW 11 100463244 missense probably benign 0.00
R3844:Klhl11 UTSW 11 100472307 missense possibly damaging 0.84
R4746:Klhl11 UTSW 11 100464350 missense probably benign 0.00
R5053:Klhl11 UTSW 11 100472200 missense probably damaging 1.00
R5426:Klhl11 UTSW 11 100464116 missense probably damaging 1.00
R5731:Klhl11 UTSW 11 100463763 missense probably damaging 1.00
R5755:Klhl11 UTSW 11 100464351 missense probably benign 0.00
R7295:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R7426:Klhl11 UTSW 11 100464352 missense probably benign 0.17
R7554:Klhl11 UTSW 11 100463948 missense probably benign
R8125:Klhl11 UTSW 11 100463985 missense probably benign
R8145:Klhl11 UTSW 11 100463914 missense probably damaging 0.99
Z1177:Klhl11 UTSW 11 100463966 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCGCACAAGCTAGACTCTC -3'
(R):5'- TTCTGCGACATCACCCTGTG -3'

Sequencing Primer
(F):5'- CACAAGCTAGACTCTCAGGGG -3'
(R):5'- GACATCACCCTGTGCTTCGG -3'
Posted On2018-10-18