Incidental Mutation 'R6874:Olfr96'
ID536340
Institutional Source Beutler Lab
Gene Symbol Olfr96
Ensembl Gene ENSMUSG00000064121
Gene Nameolfactory receptor 96
SynonymsGA_x6K02T2PSCP-1665046-1665987, MOR121-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6874 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37220146-37226673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37225347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000151151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078209] [ENSMUST00000213475] [ENSMUST00000214482]
Predicted Effect probably benign
Transcript: ENSMUST00000078209
AA Change: V74A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000077338
Gene: ENSMUSG00000064121
AA Change: V74A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.6e-53 PFAM
Pfam:7tm_1 43 291 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213475
AA Change: V74A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000214482
AA Change: V74A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Olfr96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Olfr96 APN 17 37225152 missense probably benign 0.05
IGL02151:Olfr96 APN 17 37225166 missense probably damaging 1.00
IGL02335:Olfr96 APN 17 37225326 missense probably damaging 0.97
R0360:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R0364:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R1763:Olfr96 UTSW 17 37225430 missense probably benign 0.02
R3977:Olfr96 UTSW 17 37225158 missense probably benign 0.24
R6116:Olfr96 UTSW 17 37225568 missense probably benign 0.00
R6248:Olfr96 UTSW 17 37225560 nonsense probably null
R6378:Olfr96 UTSW 17 37225797 missense probably benign 0.21
R6518:Olfr96 UTSW 17 37225268 missense probably benign 0.05
R6614:Olfr96 UTSW 17 37225899 missense probably benign 0.01
R6798:Olfr96 UTSW 17 37225806 missense probably damaging 1.00
R7468:Olfr96 UTSW 17 37225385 missense probably benign 0.01
R7820:Olfr96 UTSW 17 37225895 missense probably benign 0.00
R7852:Olfr96 UTSW 17 37225272 missense probably benign 0.01
R7935:Olfr96 UTSW 17 37225272 missense probably benign 0.01
R8322:Olfr96 UTSW 17 37225350 missense probably damaging 0.99
X0027:Olfr96 UTSW 17 37225743 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTTCCATGAAGTCCCTGGG -3'
(R):5'- AGTCCATCTACCATGAAGCCAG -3'

Sequencing Primer
(F):5'- ATGAAGTCCCTGGGCTGCAC -3'
(R):5'- ACCATTGAGGCCCCATGAG -3'
Posted On2018-10-18