Incidental Mutation 'R6874:Runx2'
ID536341
Institutional Source Beutler Lab
Gene Symbol Runx2
Ensembl Gene ENSMUSG00000039153
Gene Namerunt related transcription factor 2
Synonymspolyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6874 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44495987-44814797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44814192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 80 (P80L)
Ref Sequence ENSEMBL: ENSMUSP00000123743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000127798] [ENSMUST00000129416] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162629]
Predicted Effect probably benign
Transcript: ENSMUST00000050630
SMART Domains Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 4.5e-38 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113568
AA Change: P80L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000113571
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127798
SMART Domains Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 9.3e-39 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129416
SMART Domains Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954

DomainStartEndE-ValueType
Pfam:TFIID-18kDa 17 109 1e-38 PFAM
low complexity region 267 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130623
Predicted Effect probably damaging
Transcript: ENSMUST00000159943
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 9.2e-83 PFAM
Pfam:RunxI 434 528 7.6e-45 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000160673
AA Change: P80L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: P80L

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
coiled coil region 113 157 N/A INTRINSIC
Pfam:Runt 177 306 3.9e-75 PFAM
Pfam:RunxI 505 596 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161489
Predicted Effect probably damaging
Transcript: ENSMUST00000162629
AA Change: P12L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: P12L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
coiled coil region 45 89 N/A INTRINSIC
Pfam:Runt 106 240 3.5e-83 PFAM
Pfam:RunxI 412 506 2.7e-45 PFAM
Meta Mutation Damage Score 0.1963 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vax1 A T 19: 59,168,523 V126E unknown Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Runx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Runx2 APN 17 44658599 missense probably damaging 1.00
IGL02029:Runx2 APN 17 44658687 nonsense probably null
IGL02084:Runx2 APN 17 44724829 missense probably damaging 1.00
R0040:Runx2 UTSW 17 44608254 missense possibly damaging 0.58
R0627:Runx2 UTSW 17 44658505 intron probably benign
R0944:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R1514:Runx2 UTSW 17 44735337 missense possibly damaging 0.54
R2069:Runx2 UTSW 17 44735342 missense probably benign 0.19
R3976:Runx2 UTSW 17 44610079 missense possibly damaging 0.91
R4686:Runx2 UTSW 17 44639685 missense probably damaging 1.00
R4911:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R5241:Runx2 UTSW 17 44639777 nonsense probably null
R5526:Runx2 UTSW 17 44724862 missense probably damaging 1.00
R6566:Runx2 UTSW 17 44814488 critical splice donor site probably null
R6875:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R6980:Runx2 UTSW 17 44735316 missense possibly damaging 0.65
R7008:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7009:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7057:Runx2 UTSW 17 44814537 missense probably null
R7085:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7175:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7176:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7177:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7181:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7231:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7232:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7254:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7267:Runx2 UTSW 17 44814192 missense probably damaging 1.00
R7835:Runx2 UTSW 17 44608236 missense probably damaging 0.99
R7918:Runx2 UTSW 17 44608236 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTAGTTACACATGCCAAGTGC -3'
(R):5'- CTAACCACAGTCCATGCAGG -3'

Sequencing Primer
(F):5'- GACCTAGGAAAGCTCACA -3'
(R):5'- CCATGCAGGAATAGTAGGTCCTTC -3'
Posted On2018-10-18