Incidental Mutation 'R6874:Vax1'
ID536344
Institutional Source Beutler Lab
Gene Symbol Vax1
Ensembl Gene ENSMUSG00000006270
Gene Nameventral anterior homeobox 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R6874 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59166187-59170056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59168523 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 126 (V126E)
Ref Sequence ENSEMBL: ENSMUSP00000134642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172821]
Predicted Effect unknown
Transcript: ENSMUST00000172821
AA Change: V126E
SMART Domains Protein: ENSMUSP00000134642
Gene: ENSMUSG00000006270
AA Change: V126E

DomainStartEndE-ValueType
HOX 100 162 1.34e-27 SMART
low complexity region 187 206 N/A INTRINSIC
low complexity region 208 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the EMX homeobox protein family. The encoded protein functions as a transcription factor which is important in the development of anterior ventral forebrain and visual system. Disruption of this gene causes impairment in the developing forebrain, where the encoded protein is necessary for axon guidance and major tract formation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants exhibit cleft palate and most die at birth. A few survive to 2 weeks of age. Mutants display defects in axon guidance, coloboma, dysgenesis of the optic nerve, defects of basal telencephalon, and holoprosencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,205 D802G possibly damaging Het
Acsl5 A G 19: 55,291,863 T523A probably damaging Het
Adamts7 A T 9: 90,188,731 D635V probably damaging Het
Akr1c12 C A 13: 4,272,960 G217C probably benign Het
Astn1 C A 1: 158,664,074 S1007* probably null Het
Cntln T C 4: 85,067,759 L988P probably damaging Het
Dcps A T 9: 35,175,967 M1K probably null Het
Dnaic1 T A 4: 41,632,412 L582Q probably damaging Het
Dst A T 1: 34,289,651 Q7118L probably benign Het
Ehd2 T A 7: 15,950,438 T479S probably benign Het
Fbxl7 T C 15: 26,552,942 I80V probably benign Het
Fry T C 5: 150,437,303 V125A probably benign Het
Gm12695 A T 4: 96,785,069 I31K probably benign Het
Gm5591 T C 7: 38,520,291 E386G probably damaging Het
Helz G T 11: 107,663,634 R1219S probably damaging Het
Hes3 G T 4: 152,287,238 P85T possibly damaging Het
Igkv3-2 A T 6: 70,698,838 R44* probably null Het
Igsf9 A G 1: 172,494,529 T496A probably benign Het
Irf2bp1 G T 7: 19,005,217 A261S possibly damaging Het
Jph2 G A 2: 163,339,487 P586S probably benign Het
Klhl11 T C 11: 100,472,205 H175R probably benign Het
Ksr2 G T 5: 117,756,336 E847* probably null Het
Lats1 T A 10: 7,710,851 Y926N probably damaging Het
Lmbr1 A T 5: 29,292,906 L33H probably damaging Het
Lrp10 T C 14: 54,468,213 S287P possibly damaging Het
Map3k6 G A 4: 133,250,656 E976K probably benign Het
Mfsd6 T A 1: 52,660,709 D760V probably benign Het
Muc16 G T 9: 18,658,769 S818* probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Nagpa T C 16: 5,196,057 T306A probably benign Het
Nisch G T 14: 31,176,684 probably benign Het
Nrxn3 T C 12: 90,332,190 V1028A probably damaging Het
Nucb1 T C 7: 45,503,194 N75S probably benign Het
Olfr1058 C T 2: 86,385,528 V297I possibly damaging Het
Olfr191 T A 16: 59,085,949 Y178F probably benign Het
Olfr396-ps1 T G 11: 73,928,242 M6R probably null Het
Olfr644 T A 7: 104,068,189 I281F possibly damaging Het
Olfr832 T A 9: 18,945,481 Y278N possibly damaging Het
Olfr96 T C 17: 37,225,347 V74A probably benign Het
Olfr983 A G 9: 40,092,726 V80A probably benign Het
Pik3c2a A G 7: 116,394,305 L409S probably damaging Het
Pkhd1l1 T A 15: 44,589,527 D3949E probably benign Het
Prune2 C A 19: 17,123,228 P2032Q probably damaging Het
Ptms T C 6: 124,914,231 probably benign Het
Ptp4a3 A G 15: 73,723,410 probably benign Het
Ptprq T C 10: 107,718,599 I88M possibly damaging Het
Radil T A 5: 142,506,802 D357V probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Supt20 A G 3: 54,727,754 probably null Het
Thoc5 T C 11: 4,901,261 I69T probably damaging Het
Trib2 G C 12: 15,815,337 S79W probably damaging Het
Trpc6 A G 9: 8,680,438 D889G probably damaging Het
Usf3 T C 16: 44,219,740 S1528P probably benign Het
Vgf A G 5: 137,031,532 probably benign Het
Vmn2r1 T A 3: 64,104,955 C746S probably damaging Het
Vmn2r77 A G 7: 86,802,078 T391A probably benign Het
Zfp738 C A 13: 67,670,263 E536D possibly damaging Het
Other mutations in Vax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4297:Vax1 UTSW 19 59166251 nonsense probably null
R5753:Vax1 UTSW 19 59166382 missense probably benign 0.13
R5897:Vax1 UTSW 19 59169801 missense unknown
R6063:Vax1 UTSW 19 59168604 missense unknown
R6378:Vax1 UTSW 19 59166224 missense probably benign 0.08
R7558:Vax1 UTSW 19 59169984 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGACCTTCGTCCCCATTCG -3'
(R):5'- AGCTAGCTCTGATCAAGGAGG -3'

Sequencing Primer
(F):5'- ATTCGTTCCGTTTCCTCCACG -3'
(R):5'- CTAGCTCTGATCAAGGAGGCAGAG -3'
Posted On2018-10-18