Incidental Mutation 'R6875:Hecw2'
ID 536345
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene Name HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms A730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 044971-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R6875 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53806876-54195168 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53937132 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 166 (M166K)
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000097741] [ENSMUST00000120904]
AlphaFold Q6I6G8
Predicted Effect probably benign
Transcript: ENSMUST00000087659
AA Change: M166K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: M166K

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097741
AA Change: M166K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095348
Gene: ENSMUSG00000042807
AA Change: M166K

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 1e-87 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 292 5.92e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120904
AA Change: M166K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: M166K

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik T C 15: 12,812,068 H270R probably damaging Het
Abcb1a T C 5: 8,701,628 I336T probably benign Het
Adam19 T A 11: 46,112,875 F177I probably benign Het
Ankrd53 T C 6: 83,768,173 V455A probably damaging Het
Arrdc1 A G 2: 24,925,665 S415P probably benign Het
Atp10a T C 7: 58,797,352 L614P probably benign Het
C130060K24Rik A T 6: 65,456,336 N380I probably benign Het
Catsper1 G T 19: 5,343,963 V668F probably damaging Het
Cluh T A 11: 74,661,918 D596E probably damaging Het
Cnot10 A G 9: 114,615,107 S407P probably benign Het
Commd6 T C 14: 101,634,350 T86A probably damaging Het
D5Ertd579e A T 5: 36,604,657 probably null Het
Eif3l A G 15: 79,085,560 D252G probably damaging Het
Epha2 A T 4: 141,328,468 S962C probably damaging Het
Fcho1 C A 8: 71,714,425 probably null Het
Fgf23 G T 6: 127,073,216 G63C probably damaging Het
Flnc A T 6: 29,445,749 Y834F probably damaging Het
Gcn1l1 T C 5: 115,588,110 L608P probably damaging Het
Hdac5 T A 11: 102,202,276 E545V probably damaging Het
Ikbkb T C 8: 22,665,893 D586G probably damaging Het
Il1f9 G C 2: 24,188,621 probably null Het
Ipo13 A T 4: 117,904,911 I422N possibly damaging Het
Iqgap3 GGAGAG GGAG 3: 88,112,771 probably null Het
Kat6a G A 8: 22,932,361 A896T probably benign Het
Kif28 A G 1: 179,735,994 I139T probably damaging Het
Klhl25 A G 7: 75,866,342 E332G probably damaging Het
Krt8 C T 15: 101,997,908 A389T probably benign Het
Msrb3 T C 10: 120,784,106 S175G probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nckap5 A G 1: 126,023,194 S1519P probably benign Het
Npnt T A 3: 132,909,910 D124V probably damaging Het
Nr1d1 A T 11: 98,770,836 probably null Het
Ogdh A G 11: 6,340,477 Y365C probably benign Het
Olfr1305 A T 2: 111,872,961 I298N possibly damaging Het
Phf21b A T 15: 84,787,446 C416S probably damaging Het
Prpsap1 A G 11: 116,471,438 S373P probably damaging Het
Rab28 T C 5: 41,703,534 T26A probably damaging Het
Rbbp8nl A G 2: 180,279,226 I455T probably benign Het
Rnft2 G A 5: 118,228,818 A285V possibly damaging Het
Rrp36 G T 17: 46,672,371 Q106K probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a A G 9: 119,486,644 L1666P probably damaging Het
Siglecf A C 7: 43,355,200 T318P probably benign Het
Slc22a1 C T 17: 12,667,305 W147* probably null Het
Smchd1 T C 17: 71,353,506 I1868V probably damaging Het
Snx21 A G 2: 164,791,902 S203G probably damaging Het
Srl T C 16: 4,482,831 K792R probably benign Het
Srrt A G 5: 137,298,673 F100S probably benign Het
Stard9 G T 2: 120,697,436 M1391I probably benign Het
Syne2 A G 12: 76,035,630 E119G probably damaging Het
Syt11 G T 3: 88,762,155 S143R possibly damaging Het
Tiparp T A 3: 65,531,642 H126Q probably benign Het
Tulp2 C A 7: 45,518,614 T150K probably benign Het
Ugt2b37 T A 5: 87,242,429 Y386F probably benign Het
Usp31 C T 7: 121,649,640 W860* probably null Het
Zfp317 A G 9: 19,643,665 R30G probably damaging Het
Zfp709 C A 8: 71,889,007 N93K possibly damaging Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 splice site probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6058:Hecw2 UTSW 1 53923976 missense possibly damaging 0.67
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R8184:Hecw2 UTSW 1 54040387 missense probably benign 0.37
R8286:Hecw2 UTSW 1 53840769 missense probably damaging 1.00
R8300:Hecw2 UTSW 1 53887616 missense probably null 0.07
R8354:Hecw2 UTSW 1 53925308 critical splice donor site probably null
R8362:Hecw2 UTSW 1 54040491 start codon destroyed probably null 0.51
R8691:Hecw2 UTSW 1 53865064 missense probably benign 0.26
R8745:Hecw2 UTSW 1 53933171 missense probably damaging 1.00
R8769:Hecw2 UTSW 1 53913348 missense probably benign 0.00
R8830:Hecw2 UTSW 1 53891146 missense probably damaging 1.00
R8842:Hecw2 UTSW 1 53950874 missense
R8874:Hecw2 UTSW 1 53904449 splice site probably benign
R9064:Hecw2 UTSW 1 53826886 missense probably benign 0.08
R9326:Hecw2 UTSW 1 54040210 missense probably damaging 1.00
R9450:Hecw2 UTSW 1 53839029 nonsense probably null
R9486:Hecw2 UTSW 1 53813307 missense probably damaging 1.00
R9763:Hecw2 UTSW 1 53923915 missense probably damaging 1.00
R9766:Hecw2 UTSW 1 53865128 missense probably damaging 1.00
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTAGCGTGCAGACCATATG -3'
(R):5'- GAACACACGGTAAAGTAGATTGATT -3'

Sequencing Primer
(F):5'- CGTGCAGACCATATGAGACG -3'
(R):5'- GGAACCAATATTTTCATATCTGTTC -3'
Posted On 2018-10-18